FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628657_at:

>probe:Drosophila_2:1628657_at:428:473; Interrogation_Position=243; Antisense; GTTCATCTGGGAGAGTCACGCCATT
>probe:Drosophila_2:1628657_at:87:135; Interrogation_Position=260; Antisense; ACGCCATTTGCGCTTATCTGGTTAG
>probe:Drosophila_2:1628657_at:556:433; Interrogation_Position=297; Antisense; GAGTGATGACCTGTATCCCAAGGAT
>probe:Drosophila_2:1628657_at:295:223; Interrogation_Position=316; Antisense; AAGGATTACTTCAAACGCGCACTCG
>probe:Drosophila_2:1628657_at:390:35; Interrogation_Position=344; Antisense; ATCAGCGCCTGCACTTTGAGTCGGG
>probe:Drosophila_2:1628657_at:50:639; Interrogation_Position=364; Antisense; TCGGGTGTGTTATTCCAGGGCTGCA
>probe:Drosophila_2:1628657_at:358:27; Interrogation_Position=397; Antisense; ATAGCCATTCCGTTGTTCTACAAGA
>probe:Drosophila_2:1628657_at:460:607; Interrogation_Position=429; Antisense; TGAGGTGCCGCGTTCCCAGATTGAT
>probe:Drosophila_2:1628657_at:397:37; Interrogation_Position=457; Antisense; ATCTACGAGGCCTATGACTTTCTGG
>probe:Drosophila_2:1628657_at:728:401; Interrogation_Position=472; Antisense; GACTTTCTGGAAGCGTTCATCGGTA
>probe:Drosophila_2:1628657_at:198:31; Interrogation_Position=523; Antisense; ATAACCATCGCCGACTACAGTGTAG
>probe:Drosophila_2:1628657_at:599:665; Interrogation_Position=538; Antisense; TACAGTGTAGTTTCCTCGGTCTCCA
>probe:Drosophila_2:1628657_at:131:127; Interrogation_Position=562; Antisense; AGCCTAGTGGGATTGGCCGCTATCG
>probe:Drosophila_2:1628657_at:23:47; Interrogation_Position=587; Antisense; ATGCCAAGCGCTATCCCAAGTTAAA

Paste this into a BLAST search page for me
GTTCATCTGGGAGAGTCACGCCATTACGCCATTTGCGCTTATCTGGTTAGGAGTGATGACCTGTATCCCAAGGATAAGGATTACTTCAAACGCGCACTCGATCAGCGCCTGCACTTTGAGTCGGGTCGGGTGTGTTATTCCAGGGCTGCAATAGCCATTCCGTTGTTCTACAAGATGAGGTGCCGCGTTCCCAGATTGATATCTACGAGGCCTATGACTTTCTGGGACTTTCTGGAAGCGTTCATCGGTAATAACCATCGCCGACTACAGTGTAGTACAGTGTAGTTTCCTCGGTCTCCAAGCCTAGTGGGATTGGCCGCTATCGATGCCAAGCGCTATCCCAAGTTAAA

Full Affymetrix probeset data:

Annotations for 1628657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720