Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628658_at:

>probe:Drosophila_2:1628658_at:395:113; Interrogation_Position=1136; Antisense; AGCAGCCACCACAGGAGCAAGCGAA
>probe:Drosophila_2:1628658_at:195:361; Interrogation_Position=1182; Antisense; GCAAGAAGTCGGTGTCGCCCAACAA
>probe:Drosophila_2:1628658_at:282:139; Interrogation_Position=1206; Antisense; ACGTGCCGCTGCTGGAACCGATGGA
>probe:Drosophila_2:1628658_at:39:203; Interrogation_Position=1221; Antisense; AACCGATGGAGAGCACGCGCAGCTG
>probe:Drosophila_2:1628658_at:576:351; Interrogation_Position=1252; Antisense; GCAGACCCTGTACATAGACTTCAAG
>probe:Drosophila_2:1628658_at:687:39; Interrogation_Position=1278; Antisense; ATCTGGGCTGGCATGACTGGATCAT
>probe:Drosophila_2:1628658_at:315:589; Interrogation_Position=1295; Antisense; TGGATCATCGCACCAGAGGGCTATG
>probe:Drosophila_2:1628658_at:696:667; Interrogation_Position=1328; Antisense; TACTGCAGCGGCGAGTGCAATTTCC
>probe:Drosophila_2:1628658_at:544:243; Interrogation_Position=1346; Antisense; AATTTCCCGCTCAATGCGCACATGA
>probe:Drosophila_2:1628658_at:13:615; Interrogation_Position=1368; Antisense; TGAACGCCACGAACCATGCGATCGT
>probe:Drosophila_2:1628658_at:605:285; Interrogation_Position=1475; Antisense; CTGTACCACCTGAACGACGAGAATG
>probe:Drosophila_2:1628658_at:629:163; Interrogation_Position=1532; Antisense; AAATCCTGCGGGTGCCATTGAATTC
>probe:Drosophila_2:1628658_at:541:345; Interrogation_Position=1600; Antisense; GCATTTCTGTGTAGATGTCCATCTC
>probe:Drosophila_2:1628658_at:127:599; Interrogation_Position=1615; Antisense; TGTCCATCTCTGTACTAATCTCGAA

Paste this into a BLAST search page for me
AGCAGCCACCACAGGAGCAAGCGAAGCAAGAAGTCGGTGTCGCCCAACAAACGTGCCGCTGCTGGAACCGATGGAAACCGATGGAGAGCACGCGCAGCTGGCAGACCCTGTACATAGACTTCAAGATCTGGGCTGGCATGACTGGATCATTGGATCATCGCACCAGAGGGCTATGTACTGCAGCGGCGAGTGCAATTTCCAATTTCCCGCTCAATGCGCACATGATGAACGCCACGAACCATGCGATCGTCTGTACCACCTGAACGACGAGAATGAAATCCTGCGGGTGCCATTGAATTCGCATTTCTGTGTAGATGTCCATCTCTGTCCATCTCTGTACTAATCTCGAA

Full Affymetrix probeset data:

Annotations for 1628658_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime