FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628659_at:

>probe:Drosophila_2:1628659_at:252:451; Interrogation_Position=3681; Antisense; GATCGCACCATTGCCGAGAACATAG
>probe:Drosophila_2:1628659_at:383:27; Interrogation_Position=3702; Antisense; ATAGCTTATGGCAACAATTTCCGTG
>probe:Drosophila_2:1628659_at:463:19; Interrogation_Position=3718; Antisense; ATTTCCGTGACGATGTGTCCATGCA
>probe:Drosophila_2:1628659_at:594:703; Interrogation_Position=3784; Antisense; TTATAAGTGCTTTGCCCCAAGGCTA
>probe:Drosophila_2:1628659_at:466:219; Interrogation_Position=3802; Antisense; AAGGCTACGACACCCGACTGGGCAA
>probe:Drosophila_2:1628659_at:336:253; Interrogation_Position=3824; Antisense; CAAGACATCGCAGCTCTCTGGAGGT
>probe:Drosophila_2:1628659_at:47:41; Interrogation_Position=3867; Antisense; ATCGCTCGAGCCCTGGTTAGAAACC
>probe:Drosophila_2:1628659_at:332:391; Interrogation_Position=3886; Antisense; GAAACCCGAAGATACTCATCCTGGA
>probe:Drosophila_2:1628659_at:520:443; Interrogation_Position=3966; Antisense; GATGAGGCGAGATCAGGCCGCACAT
>probe:Drosophila_2:1628659_at:77:509; Interrogation_Position=4020; Antisense; GTGCGGAATGCGGATCTCATCTGTG
>probe:Drosophila_2:1628659_at:93:647; Interrogation_Position=4036; Antisense; TCATCTGTGTGCTAAAACGCGGCGT
>probe:Drosophila_2:1628659_at:622:111; Interrogation_Position=4069; Antisense; AGCACGGCACCCACGATGAGTTGAT
>probe:Drosophila_2:1628659_at:406:673; Interrogation_Position=4110; Antisense; TACGCCAATCTCTATCTGATGCAAC
>probe:Drosophila_2:1628659_at:366:285; Interrogation_Position=4125; Antisense; CTGATGCAACAGGTGTCGGGCTAAC

Paste this into a BLAST search page for me
GATCGCACCATTGCCGAGAACATAGATAGCTTATGGCAACAATTTCCGTGATTTCCGTGACGATGTGTCCATGCATTATAAGTGCTTTGCCCCAAGGCTAAAGGCTACGACACCCGACTGGGCAACAAGACATCGCAGCTCTCTGGAGGTATCGCTCGAGCCCTGGTTAGAAACCGAAACCCGAAGATACTCATCCTGGAGATGAGGCGAGATCAGGCCGCACATGTGCGGAATGCGGATCTCATCTGTGTCATCTGTGTGCTAAAACGCGGCGTAGCACGGCACCCACGATGAGTTGATTACGCCAATCTCTATCTGATGCAACCTGATGCAACAGGTGTCGGGCTAAC

Full Affymetrix probeset data:

Annotations for 1628659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720