FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628660_at:

>probe:Drosophila_2:1628660_at:175:559; Interrogation_Position=111; Antisense; GGACAAGAACGACCATCCGCAGGCC
>probe:Drosophila_2:1628660_at:660:45; Interrogation_Position=125; Antisense; ATCCGCAGGCCGAGGAGCAGTTTAG
>probe:Drosophila_2:1628660_at:255:303; Interrogation_Position=161; Antisense; CCGCCTTCGAAGTGCTCTTTGATAA
>probe:Drosophila_2:1628660_at:717:173; Interrogation_Position=189; Antisense; AAAGCGCGAGATATACGACCAGCAC
>probe:Drosophila_2:1628660_at:724:457; Interrogation_Position=198; Antisense; GATATACGACCAGCACGGCGAGGAG
>probe:Drosophila_2:1628660_at:679:167; Interrogation_Position=229; Antisense; AAATGTGATGACGAGCCTGCTGCGA
>probe:Drosophila_2:1628660_at:518:647; Interrogation_Position=287; Antisense; TCATGTGCGCCGTCGGAGGAACCGT
>probe:Drosophila_2:1628660_at:178:437; Interrogation_Position=302; Antisense; GAGGAACCGTGCTCTTTGCGTTCGC
>probe:Drosophila_2:1628660_at:563:623; Interrogation_Position=318; Antisense; TGCGTTCGCCGCCTACAAGACATTC
>probe:Drosophila_2:1628660_at:56:213; Interrogation_Position=334; Antisense; AAGACATTCCAGTTCTTCAACCGGA
>probe:Drosophila_2:1628660_at:613:179; Interrogation_Position=359; Antisense; AAAAAGAGGCTACCCACGGCGATGG
>probe:Drosophila_2:1628660_at:87:143; Interrogation_Position=374; Antisense; ACGGCGATGGATCCTCCTCGGACTG
>probe:Drosophila_2:1628660_at:295:563; Interrogation_Position=50; Antisense; GGAATGCGTCCAGCGAAGACGTCAA
>probe:Drosophila_2:1628660_at:586:69; Interrogation_Position=68; Antisense; ACGTCAAGAAGGGATACCGCCGGAT

Paste this into a BLAST search page for me
GGACAAGAACGACCATCCGCAGGCCATCCGCAGGCCGAGGAGCAGTTTAGCCGCCTTCGAAGTGCTCTTTGATAAAAAGCGCGAGATATACGACCAGCACGATATACGACCAGCACGGCGAGGAGAAATGTGATGACGAGCCTGCTGCGATCATGTGCGCCGTCGGAGGAACCGTGAGGAACCGTGCTCTTTGCGTTCGCTGCGTTCGCCGCCTACAAGACATTCAAGACATTCCAGTTCTTCAACCGGAAAAAAGAGGCTACCCACGGCGATGGACGGCGATGGATCCTCCTCGGACTGGGAATGCGTCCAGCGAAGACGTCAAACGTCAAGAAGGGATACCGCCGGAT

Full Affymetrix probeset data:

Annotations for 1628660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720