FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628661_at:

>probe:Drosophila_2:1628661_at:102:327; Interrogation_Position=205; Antisense; GCGAGCGTATCAAGATTGCCACTAC
>probe:Drosophila_2:1628661_at:512:719; Interrogation_Position=220; Antisense; TTGCCACTACAAACGATGCTCATTT
>probe:Drosophila_2:1628661_at:709:161; Interrogation_Position=293; Antisense; ACAATTGGACTGCATGCAGCGCCAC
>probe:Drosophila_2:1628661_at:143:261; Interrogation_Position=315; Antisense; CACGCCGAGGGCCATGGACATTTAT
>probe:Drosophila_2:1628661_at:703:69; Interrogation_Position=349; Antisense; AGGCCATCTCCCTAAATGAGCAGCA
>probe:Drosophila_2:1628661_at:218:213; Interrogation_Position=384; Antisense; AAGACTGATAAGCAGGCGCCCAAGG
>probe:Drosophila_2:1628661_at:78:35; Interrogation_Position=459; Antisense; ATCACAACATCTTCCGACTCGGATG
>probe:Drosophila_2:1628661_at:351:569; Interrogation_Position=513; Antisense; GGCATAGCAGGCATTTCCGGTACGA
>probe:Drosophila_2:1628661_at:694:719; Interrogation_Position=527; Antisense; TTCCGGTACGAATGCAATGCGCTGC
>probe:Drosophila_2:1628661_at:266:359; Interrogation_Position=550; Antisense; GCAACAATGGAATCCGCTCCAGTTC
>probe:Drosophila_2:1628661_at:37:267; Interrogation_Position=569; Antisense; CAGTTCCTGTGGCAAGCGGCAGCAA
>probe:Drosophila_2:1628661_at:490:253; Interrogation_Position=591; Antisense; CAACGTGGATGCTGCAACTGCGGCA
>probe:Drosophila_2:1628661_at:476:331; Interrogation_Position=610; Antisense; GCGGCAGCCGCAAGAACTTCGACGA
>probe:Drosophila_2:1628661_at:214:335; Interrogation_Position=637; Antisense; GCTGCAACCACACCATTAGCAAGTT

Paste this into a BLAST search page for me
GCGAGCGTATCAAGATTGCCACTACTTGCCACTACAAACGATGCTCATTTACAATTGGACTGCATGCAGCGCCACCACGCCGAGGGCCATGGACATTTATAGGCCATCTCCCTAAATGAGCAGCAAAGACTGATAAGCAGGCGCCCAAGGATCACAACATCTTCCGACTCGGATGGGCATAGCAGGCATTTCCGGTACGATTCCGGTACGAATGCAATGCGCTGCGCAACAATGGAATCCGCTCCAGTTCCAGTTCCTGTGGCAAGCGGCAGCAACAACGTGGATGCTGCAACTGCGGCAGCGGCAGCCGCAAGAACTTCGACGAGCTGCAACCACACCATTAGCAAGTT

Full Affymetrix probeset data:

Annotations for 1628661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720