FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628662_at:

>probe:Drosophila_2:1628662_at:330:325; Interrogation_Position=5002; Antisense; GCGAATCATTTGTGTGTCAGCGTCA
>probe:Drosophila_2:1628662_at:110:497; Interrogation_Position=5017; Antisense; GTCAGCGTCATTGGAGTGCGTTCTA
>probe:Drosophila_2:1628662_at:99:479; Interrogation_Position=5049; Antisense; GTTTCGGGAGCTAGTCAACGTCCAT
>probe:Drosophila_2:1628662_at:15:209; Interrogation_Position=5087; Antisense; AAGCTCTGATTCTGAGTCGCGCCTA
>probe:Drosophila_2:1628662_at:669:431; Interrogation_Position=5100; Antisense; GAGTCGCGCCTATGGTTATGATATT
>probe:Drosophila_2:1628662_at:686:379; Interrogation_Position=5134; Antisense; GAAGCCATCTTGTCTCAATTCGTTG
>probe:Drosophila_2:1628662_at:427:249; Interrogation_Position=5149; Antisense; CAATTCGTTGTGCTTCAGGGAGTCA
>probe:Drosophila_2:1628662_at:360:365; Interrogation_Position=5185; Antisense; GAATATCTGTGCCATCAGCGCATCA
>probe:Drosophila_2:1628662_at:206:475; Interrogation_Position=5233; Antisense; GTTAAGGGTTATTTGCTGCACATCC
>probe:Drosophila_2:1628662_at:88:407; Interrogation_Position=5309; Antisense; GACTGATCAAGTCCGTGGTTCTCAA
>probe:Drosophila_2:1628662_at:619:119; Interrogation_Position=5339; Antisense; AGCTGGCATCCATTTTGGGCTTCAA
>probe:Drosophila_2:1628662_at:5:595; Interrogation_Position=5354; Antisense; TGGGCTTCAAGTCCATCGTGATGTC
>probe:Drosophila_2:1628662_at:663:137; Interrogation_Position=5387; Antisense; ACGATTCCTCCGTTTATTATCTTAG
>probe:Drosophila_2:1628662_at:571:487; Interrogation_Position=5429; Antisense; GTACCGATTTCCACACAGCAGGAGA

Paste this into a BLAST search page for me
GCGAATCATTTGTGTGTCAGCGTCAGTCAGCGTCATTGGAGTGCGTTCTAGTTTCGGGAGCTAGTCAACGTCCATAAGCTCTGATTCTGAGTCGCGCCTAGAGTCGCGCCTATGGTTATGATATTGAAGCCATCTTGTCTCAATTCGTTGCAATTCGTTGTGCTTCAGGGAGTCAGAATATCTGTGCCATCAGCGCATCAGTTAAGGGTTATTTGCTGCACATCCGACTGATCAAGTCCGTGGTTCTCAAAGCTGGCATCCATTTTGGGCTTCAATGGGCTTCAAGTCCATCGTGATGTCACGATTCCTCCGTTTATTATCTTAGGTACCGATTTCCACACAGCAGGAGA

Full Affymetrix probeset data:

Annotations for 1628662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720