Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628665_at:

>probe:Drosophila_2:1628665_at:641:631; Interrogation_Position=2833; Antisense; TCCTGGTGTCGGGTCAGCAAGAACA
>probe:Drosophila_2:1628665_at:314:383; Interrogation_Position=2862; Antisense; GAACTGGCAGTTCAAGACACCTGAG
>probe:Drosophila_2:1628665_at:395:399; Interrogation_Position=2877; Antisense; GACACCTGAGGTGCTGCGTGCTGTT
>probe:Drosophila_2:1628665_at:717:621; Interrogation_Position=2891; Antisense; TGCGTGCTGTTGTCCGGGAGCTATC
>probe:Drosophila_2:1628665_at:454:417; Interrogation_Position=2908; Antisense; GAGCTATCCATACCCATCTAAGTTT
>probe:Drosophila_2:1628665_at:548:13; Interrogation_Position=2946; Antisense; ATTAAACGCGTGGAGCCTAGCGCTG
>probe:Drosophila_2:1628665_at:671:283; Interrogation_Position=2968; Antisense; CTGCACTTCTCTATAGCCTTTAATT
>probe:Drosophila_2:1628665_at:465:559; Interrogation_Position=3042; Antisense; GGACAAAACTGACAGCAGCTCCACA
>probe:Drosophila_2:1628665_at:468:215; Interrogation_Position=3071; Antisense; AAGATCCCCAAAGCATACCGGCATT
>probe:Drosophila_2:1628665_at:538:311; Interrogation_Position=3103; Antisense; GCCAATGGAGACAAATCCGCCAACT
>probe:Drosophila_2:1628665_at:642:593; Interrogation_Position=3141; Antisense; TGGGCTTCTGAGGAATCCACTTTCG
>probe:Drosophila_2:1628665_at:635:461; Interrogation_Position=3174; Antisense; GATTCACCAAGCTTACTTCTCGCTG
>probe:Drosophila_2:1628665_at:359:335; Interrogation_Position=3195; Antisense; GCTGCCAGCGTAGTCTGTGGGTTAA
>probe:Drosophila_2:1628665_at:654:513; Interrogation_Position=3226; Antisense; GTGTTTTATGATTTCCTCTTTTCGA

Paste this into a BLAST search page for me
TCCTGGTGTCGGGTCAGCAAGAACAGAACTGGCAGTTCAAGACACCTGAGGACACCTGAGGTGCTGCGTGCTGTTTGCGTGCTGTTGTCCGGGAGCTATCGAGCTATCCATACCCATCTAAGTTTATTAAACGCGTGGAGCCTAGCGCTGCTGCACTTCTCTATAGCCTTTAATTGGACAAAACTGACAGCAGCTCCACAAAGATCCCCAAAGCATACCGGCATTGCCAATGGAGACAAATCCGCCAACTTGGGCTTCTGAGGAATCCACTTTCGGATTCACCAAGCTTACTTCTCGCTGGCTGCCAGCGTAGTCTGTGGGTTAAGTGTTTTATGATTTCCTCTTTTCGA

Full Affymetrix probeset data:

Annotations for 1628665_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime