FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628666_at:

>probe:Drosophila_2:1628666_at:209:231; Interrogation_Position=4192; Antisense; AATGTCAGCTATGTGGTTCCGGTAT
>probe:Drosophila_2:1628666_at:7:685; Interrogation_Position=4214; Antisense; TATCGCGCTATCTGCAGGCCAGTAG
>probe:Drosophila_2:1628666_at:664:311; Interrogation_Position=4231; Antisense; GCCAGTAGTCTGGAGCTCCATCTGA
>probe:Drosophila_2:1628666_at:628:83; Interrogation_Position=4274; Antisense; AGTGGTCCATCTGCGTCGACGAGGA
>probe:Drosophila_2:1628666_at:78:79; Interrogation_Position=4295; Antisense; AGGATCAGGCCAAGCCGAGTGCCAA
>probe:Drosophila_2:1628666_at:427:627; Interrogation_Position=4314; Antisense; TGCCAACGGCCAGCTGAACGAGGAT
>probe:Drosophila_2:1628666_at:294:511; Interrogation_Position=4363; Antisense; GTGAAGATCCTCAAGCAGCAGGGCA
>probe:Drosophila_2:1628666_at:276:211; Interrogation_Position=4387; Antisense; AAGAACAAACTGAGCCTGGCCCTGG
>probe:Drosophila_2:1628666_at:703:327; Interrogation_Position=4424; Antisense; GCGGCTACTTCCTACGGGAGTTTAT
>probe:Drosophila_2:1628666_at:433:645; Interrogation_Position=4561; Antisense; TCAGCTTAATTTATGGCACGGACCG
>probe:Drosophila_2:1628666_at:37:567; Interrogation_Position=4575; Antisense; GGCACGGACCGAATCTGAACTCTAA
>probe:Drosophila_2:1628666_at:485:383; Interrogation_Position=4591; Antisense; GAACTCTAAAACCATGTGCGTGTGC
>probe:Drosophila_2:1628666_at:123:263; Interrogation_Position=4615; Antisense; CAGCACGTTTCGGTGTTGCGGATGT
>probe:Drosophila_2:1628666_at:174:261; Interrogation_Position=4647; Antisense; CACCTGGCGCGGAAAAATCGTTTGA

Paste this into a BLAST search page for me
AATGTCAGCTATGTGGTTCCGGTATTATCGCGCTATCTGCAGGCCAGTAGGCCAGTAGTCTGGAGCTCCATCTGAAGTGGTCCATCTGCGTCGACGAGGAAGGATCAGGCCAAGCCGAGTGCCAATGCCAACGGCCAGCTGAACGAGGATGTGAAGATCCTCAAGCAGCAGGGCAAAGAACAAACTGAGCCTGGCCCTGGGCGGCTACTTCCTACGGGAGTTTATTCAGCTTAATTTATGGCACGGACCGGGCACGGACCGAATCTGAACTCTAAGAACTCTAAAACCATGTGCGTGTGCCAGCACGTTTCGGTGTTGCGGATGTCACCTGGCGCGGAAAAATCGTTTGA

Full Affymetrix probeset data:

Annotations for 1628666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720