Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628667_at:

>probe:Drosophila_2:1628667_at:578:621; Interrogation_Position=1371; Antisense; TGCGGCTTCTGCAGCGAAACATTCG
>probe:Drosophila_2:1628667_at:212:209; Interrogation_Position=1416; Antisense; AAGCACGAGAGCGAGGTCCACAATG
>probe:Drosophila_2:1628667_at:290:623; Interrogation_Position=1439; Antisense; TGCGGCGCCTCGTCTCATTGTGAAG
>probe:Drosophila_2:1628667_at:135:271; Interrogation_Position=1481; Antisense; CATGCCCAAGCCTCGAGAAAGTGTG
>probe:Drosophila_2:1628667_at:362:333; Interrogation_Position=1558; Antisense; GCTGGCATATCAAATCGCACACCGA
>probe:Drosophila_2:1628667_at:279:447; Interrogation_Position=1581; Antisense; GATGCGAACGCCTACAAGTGCCAGC
>probe:Drosophila_2:1628667_at:30:619; Interrogation_Position=1608; Antisense; TGCAGCAAGAGCTACTCGGATCCCA
>probe:Drosophila_2:1628667_at:419:255; Interrogation_Position=1631; Antisense; CAACAAGCTCAAGCGCCACGAGATG
>probe:Drosophila_2:1628667_at:239:109; Interrogation_Position=1663; Antisense; AGAAGAGGCCGCTCCAGTGCGACGT
>probe:Drosophila_2:1628667_at:713:621; Interrogation_Position=1680; Antisense; TGCGACGTCTGCTTGAAGGGATTCT
>probe:Drosophila_2:1628667_at:428:81; Interrogation_Position=1696; Antisense; AGGGATTCTATCAGCGGACGCGGCT
>probe:Drosophila_2:1628667_at:28:131; Interrogation_Position=1743; Antisense; ACCGGCGAACGTCCATATTGGTGCG
>probe:Drosophila_2:1628667_at:397:539; Interrogation_Position=1769; Antisense; GGTTTGCAATGTTAACTTTCGCTAC
>probe:Drosophila_2:1628667_at:538:201; Interrogation_Position=1874; Antisense; AACCGAATGAAATGCGTGCTTCTTT

Paste this into a BLAST search page for me
TGCGGCTTCTGCAGCGAAACATTCGAAGCACGAGAGCGAGGTCCACAATGTGCGGCGCCTCGTCTCATTGTGAAGCATGCCCAAGCCTCGAGAAAGTGTGGCTGGCATATCAAATCGCACACCGAGATGCGAACGCCTACAAGTGCCAGCTGCAGCAAGAGCTACTCGGATCCCACAACAAGCTCAAGCGCCACGAGATGAGAAGAGGCCGCTCCAGTGCGACGTTGCGACGTCTGCTTGAAGGGATTCTAGGGATTCTATCAGCGGACGCGGCTACCGGCGAACGTCCATATTGGTGCGGGTTTGCAATGTTAACTTTCGCTACAACCGAATGAAATGCGTGCTTCTTT

Full Affymetrix probeset data:

Annotations for 1628667_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime