Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628669_at:

>probe:Drosophila_2:1628669_at:447:665; Interrogation_Position=1432; Antisense; TACAAGTTCAATTCCACGCCCGGAA
>probe:Drosophila_2:1628669_at:240:129; Interrogation_Position=1447; Antisense; ACGCCCGGAACCAGGATTGATTTGT
>probe:Drosophila_2:1628669_at:246:571; Interrogation_Position=1500; Antisense; GGCTACTAAGAGGTTACTGCGTCTA
>probe:Drosophila_2:1628669_at:113:523; Interrogation_Position=1537; Antisense; GTGGCGCGCCTTAAGGAGCTACAGA
>probe:Drosophila_2:1628669_at:362:421; Interrogation_Position=1560; Antisense; GAGCACAGTTAAGCCATCGCAGCGA
>probe:Drosophila_2:1628669_at:360:521; Interrogation_Position=1617; Antisense; GGGCCTGGCTCCGACAGAGGAACAA
>probe:Drosophila_2:1628669_at:300:391; Interrogation_Position=1642; Antisense; GAAACGGCTACGCTGTACAAGAATG
>probe:Drosophila_2:1628669_at:531:583; Interrogation_Position=1707; Antisense; TGGCACCCAGGTTCGCTTGGAGAGC
>probe:Drosophila_2:1628669_at:536:523; Interrogation_Position=1742; Antisense; GGGCCTTTTGGCAAAATCCGCACTT
>probe:Drosophila_2:1628669_at:43:501; Interrogation_Position=1794; Antisense; GTCGAACGTTATGTTAGCCCTGCAG
>probe:Drosophila_2:1628669_at:420:559; Interrogation_Position=1818; Antisense; GGAAATCTACCAAACACTGCCTAGT
>probe:Drosophila_2:1628669_at:106:585; Interrogation_Position=1874; Antisense; TGGCACCTGCTCTGGCAATAATAAA
>probe:Drosophila_2:1628669_at:657:531; Interrogation_Position=1899; Antisense; GGGTCGACAGCCATAGTATTCAATA
>probe:Drosophila_2:1628669_at:568:457; Interrogation_Position=1924; Antisense; GATAGTCTAATCCAACAACCCACTT

Paste this into a BLAST search page for me
TACAAGTTCAATTCCACGCCCGGAAACGCCCGGAACCAGGATTGATTTGTGGCTACTAAGAGGTTACTGCGTCTAGTGGCGCGCCTTAAGGAGCTACAGAGAGCACAGTTAAGCCATCGCAGCGAGGGCCTGGCTCCGACAGAGGAACAAGAAACGGCTACGCTGTACAAGAATGTGGCACCCAGGTTCGCTTGGAGAGCGGGCCTTTTGGCAAAATCCGCACTTGTCGAACGTTATGTTAGCCCTGCAGGGAAATCTACCAAACACTGCCTAGTTGGCACCTGCTCTGGCAATAATAAAGGGTCGACAGCCATAGTATTCAATAGATAGTCTAATCCAACAACCCACTT

Full Affymetrix probeset data:

Annotations for 1628669_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime