FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628670_at:

>probe:Drosophila_2:1628670_at:681:499; Interrogation_Position=101; Antisense; GTCTGATCCTGCTGGTGTGGCAGAA
>probe:Drosophila_2:1628670_at:501:237; Interrogation_Position=124; Antisense; AATCTCGCCGAGAAGTGCCACAAAT
>probe:Drosophila_2:1628670_at:715:61; Interrogation_Position=13; Antisense; ATGTCGTCGTGGGTTGTCTCCACCA
>probe:Drosophila_2:1628670_at:665:503; Interrogation_Position=138; Antisense; GTGCCACAAATTCGGAAGTTTTCTC
>probe:Drosophila_2:1628670_at:723:509; Interrogation_Position=167; Antisense; GTGAAACGAATAAACCGCTGCCCAA
>probe:Drosophila_2:1628670_at:292:381; Interrogation_Position=193; Antisense; GAACTGAGGCGATCGTTACGTCTTA
>probe:Drosophila_2:1628670_at:487:667; Interrogation_Position=209; Antisense; TACGTCTTAACAAATCGGCCCGCCG
>probe:Drosophila_2:1628670_at:473:319; Interrogation_Position=226; Antisense; GCCCGCCGGAAAGGCTATCGGAGTT
>probe:Drosophila_2:1628670_at:434:415; Interrogation_Position=283; Antisense; GAGCGTTTAAACGAACCCATCAACA
>probe:Drosophila_2:1628670_at:71:35; Interrogation_Position=301; Antisense; ATCAACATCTCCATTCGCATGGGAC
>probe:Drosophila_2:1628670_at:100:299; Interrogation_Position=316; Antisense; CGCATGGGACCTGCCTATGACTATA
>probe:Drosophila_2:1628670_at:97:609; Interrogation_Position=333; Antisense; TGACTATAGGCCATCGAATTTCTGA
>probe:Drosophila_2:1628670_at:542:295; Interrogation_Position=39; Antisense; CGAGCTGCGCGATTGTGGTACCAAA
>probe:Drosophila_2:1628670_at:707:465; Interrogation_Position=49; Antisense; GATTGTGGTACCAAAGGCTCCAAAG

Paste this into a BLAST search page for me
GTCTGATCCTGCTGGTGTGGCAGAAAATCTCGCCGAGAAGTGCCACAAATATGTCGTCGTGGGTTGTCTCCACCAGTGCCACAAATTCGGAAGTTTTCTCGTGAAACGAATAAACCGCTGCCCAAGAACTGAGGCGATCGTTACGTCTTATACGTCTTAACAAATCGGCCCGCCGGCCCGCCGGAAAGGCTATCGGAGTTGAGCGTTTAAACGAACCCATCAACAATCAACATCTCCATTCGCATGGGACCGCATGGGACCTGCCTATGACTATATGACTATAGGCCATCGAATTTCTGACGAGCTGCGCGATTGTGGTACCAAAGATTGTGGTACCAAAGGCTCCAAAG

Full Affymetrix probeset data:

Annotations for 1628670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720