FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628672_at:

>probe:Drosophila_2:1628672_at:137:525; Interrogation_Position=1028; Antisense; GGGCTTGGCAACTATAAATGTCTGT
>probe:Drosophila_2:1628672_at:244:31; Interrogation_Position=1041; Antisense; ATAAATGTCTGTCGCTTAGTTAGAG
>probe:Drosophila_2:1628672_at:617:609; Interrogation_Position=747; Antisense; TGACGCCACGTACCGGGCAACTCGT
>probe:Drosophila_2:1628672_at:62:195; Interrogation_Position=765; Antisense; AACTCGTTCTGCCATTTTGGCATGC
>probe:Drosophila_2:1628672_at:450:353; Interrogation_Position=817; Antisense; GCACTTATAAGGCAGGCAGACCCGA
>probe:Drosophila_2:1628672_at:170:565; Interrogation_Position=831; Antisense; GGCAGACCCGACTCATTGGTTACAA
>probe:Drosophila_2:1628672_at:114:665; Interrogation_Position=851; Antisense; TACAAGGTAAAGTCCATATGCCAAG
>probe:Drosophila_2:1628672_at:78:25; Interrogation_Position=866; Antisense; ATATGCCAAGATGATGAGTCCATTG
>probe:Drosophila_2:1628672_at:162:433; Interrogation_Position=881; Antisense; GAGTCCATTGAAAGGTTGAATCTCA
>probe:Drosophila_2:1628672_at:394:615; Interrogation_Position=897; Antisense; TGAATCTCAAATGGCCAACTCACGC
>probe:Drosophila_2:1628672_at:361:193; Interrogation_Position=913; Antisense; AACTCACGCACCTTTTGCGGCAGAA
>probe:Drosophila_2:1628672_at:198:277; Interrogation_Position=938; Antisense; CTAATGATGCGATTGTGATGGCTTC
>probe:Drosophila_2:1628672_at:264:441; Interrogation_Position=954; Antisense; GATGGCTTCACGGAGATTCTATCTA
>probe:Drosophila_2:1628672_at:365:265; Interrogation_Position=985; Antisense; CAGTCGTTAGATGTGCTGGGTAAGA

Paste this into a BLAST search page for me
GGGCTTGGCAACTATAAATGTCTGTATAAATGTCTGTCGCTTAGTTAGAGTGACGCCACGTACCGGGCAACTCGTAACTCGTTCTGCCATTTTGGCATGCGCACTTATAAGGCAGGCAGACCCGAGGCAGACCCGACTCATTGGTTACAATACAAGGTAAAGTCCATATGCCAAGATATGCCAAGATGATGAGTCCATTGGAGTCCATTGAAAGGTTGAATCTCATGAATCTCAAATGGCCAACTCACGCAACTCACGCACCTTTTGCGGCAGAACTAATGATGCGATTGTGATGGCTTCGATGGCTTCACGGAGATTCTATCTACAGTCGTTAGATGTGCTGGGTAAGA

Full Affymetrix probeset data:

Annotations for 1628672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720