FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628673_at:

>probe:Drosophila_2:1628673_at:178:439; Interrogation_Position=1763; Antisense; GAGGAAGCAGTTACCCAGAGCACGT
>probe:Drosophila_2:1628673_at:546:101; Interrogation_Position=1779; Antisense; AGAGCACGTCTCTGCAATGCAAGGT
>probe:Drosophila_2:1628673_at:26:561; Interrogation_Position=1813; Antisense; GGAAACCAATTTATCAGCGCGTGAG
>probe:Drosophila_2:1628673_at:331:25; Interrogation_Position=1907; Antisense; ATAGATCCTCGAATTGCCAGTGCTC
>probe:Drosophila_2:1628673_at:43:315; Interrogation_Position=1922; Antisense; GCCAGTGCTCTGGATGCTAGCGTAC
>probe:Drosophila_2:1628673_at:650:181; Interrogation_Position=1950; Antisense; AAAAGAGTGCTGATCTCGTCGAGGA
>probe:Drosophila_2:1628673_at:327:437; Interrogation_Position=2003; Antisense; GAGGAGCAACTCATGACCTCCGCTT
>probe:Drosophila_2:1628673_at:519:629; Interrogation_Position=2021; Antisense; TCCGCTTTCTACAGACTGGGTGTCA
>probe:Drosophila_2:1628673_at:432:515; Interrogation_Position=2040; Antisense; GTGTCAATGCCCAGCGTGATGCAAT
>probe:Drosophila_2:1628673_at:421:513; Interrogation_Position=2055; Antisense; GTGATGCAATCGACTCTAAGCTGGC
>probe:Drosophila_2:1628673_at:404:689; Interrogation_Position=2082; Antisense; TATTGATGGGCTCTGGCCAGACATT
>probe:Drosophila_2:1628673_at:53:573; Interrogation_Position=2189; Antisense; GGCTAAGTCTCATTTCTTGTTTGAA
>probe:Drosophila_2:1628673_at:272:161; Interrogation_Position=2237; Antisense; ACAAGTATTTATTGGACCTCCGCAA
>probe:Drosophila_2:1628673_at:303:555; Interrogation_Position=2250; Antisense; GGACCTCCGCAAGGATCTATATCGT

Paste this into a BLAST search page for me
GAGGAAGCAGTTACCCAGAGCACGTAGAGCACGTCTCTGCAATGCAAGGTGGAAACCAATTTATCAGCGCGTGAGATAGATCCTCGAATTGCCAGTGCTCGCCAGTGCTCTGGATGCTAGCGTACAAAAGAGTGCTGATCTCGTCGAGGAGAGGAGCAACTCATGACCTCCGCTTTCCGCTTTCTACAGACTGGGTGTCAGTGTCAATGCCCAGCGTGATGCAATGTGATGCAATCGACTCTAAGCTGGCTATTGATGGGCTCTGGCCAGACATTGGCTAAGTCTCATTTCTTGTTTGAAACAAGTATTTATTGGACCTCCGCAAGGACCTCCGCAAGGATCTATATCGT

Full Affymetrix probeset data:

Annotations for 1628673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720