Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628675_at:

>probe:Drosophila_2:1628675_at:242:207; Interrogation_Position=2121; Antisense; AAGCACCGATCCTTGTACTTTTGAT
>probe:Drosophila_2:1628675_at:259:453; Interrogation_Position=2143; Antisense; GATCATGCTACACTTTTCAAGACGT
>probe:Drosophila_2:1628675_at:150:547; Interrogation_Position=2184; Antisense; GGAGTATAGGCTCAACGACCCATAT
>probe:Drosophila_2:1628675_at:53:693; Interrogation_Position=2225; Antisense; TTAGTCCTGGTCAAGTTTTCGTGTT
>probe:Drosophila_2:1628675_at:435:21; Interrogation_Position=2256; Antisense; ATATTGCGCTCGATATGGTGTCCGA
>probe:Drosophila_2:1628675_at:381:531; Interrogation_Position=2272; Antisense; GGTGTCCGAGGATGCTACAGGCACT
>probe:Drosophila_2:1628675_at:600:355; Interrogation_Position=2292; Antisense; GCACTTATGCTACCTTTCTGATTTA
>probe:Drosophila_2:1628675_at:359:641; Interrogation_Position=2308; Antisense; TCTGATTTACTGGATCGTGCCGAAA
>probe:Drosophila_2:1628675_at:119:653; Interrogation_Position=2357; Antisense; TAATTCACTATTCATTCGCCTTCTG
>probe:Drosophila_2:1628675_at:467:715; Interrogation_Position=2377; Antisense; TTCTGCGCGAGCCACGTACATGGAA
>probe:Drosophila_2:1628675_at:347:31; Interrogation_Position=2467; Antisense; ATCAAAGAACGCCTACGCCAGTTAC
>probe:Drosophila_2:1628675_at:395:455; Interrogation_Position=2516; Antisense; GATACTGTTTTCCATTTGGTCGCCC
>probe:Drosophila_2:1628675_at:415:591; Interrogation_Position=2532; Antisense; TGGTCGCCCCGAAGGTGCACTCAAA
>probe:Drosophila_2:1628675_at:65:297; Interrogation_Position=2606; Antisense; CCGTTCCACCTGAAGAAGTTCGTCA

Paste this into a BLAST search page for me
AAGCACCGATCCTTGTACTTTTGATGATCATGCTACACTTTTCAAGACGTGGAGTATAGGCTCAACGACCCATATTTAGTCCTGGTCAAGTTTTCGTGTTATATTGCGCTCGATATGGTGTCCGAGGTGTCCGAGGATGCTACAGGCACTGCACTTATGCTACCTTTCTGATTTATCTGATTTACTGGATCGTGCCGAAATAATTCACTATTCATTCGCCTTCTGTTCTGCGCGAGCCACGTACATGGAAATCAAAGAACGCCTACGCCAGTTACGATACTGTTTTCCATTTGGTCGCCCTGGTCGCCCCGAAGGTGCACTCAAACCGTTCCACCTGAAGAAGTTCGTCA

Full Affymetrix probeset data:

Annotations for 1628675_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime