Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628676_at:

>probe:Drosophila_2:1628676_at:221:661; Interrogation_Position=5123; Antisense; TAAAGTCCTTTACCGTAATGTGCAA
>probe:Drosophila_2:1628676_at:562:247; Interrogation_Position=5213; Antisense; AATTGTTTTTCTTTCTCGCACGAAG
>probe:Drosophila_2:1628676_at:157:285; Interrogation_Position=5261; Antisense; CTGATCCTGCTTAATCTACCGTGAA
>probe:Drosophila_2:1628676_at:532:43; Interrogation_Position=5296; Antisense; ATCGCCAGGCCTCTAAAGTTTTGTA
>probe:Drosophila_2:1628676_at:274:177; Interrogation_Position=5334; Antisense; AAACATCCGAGTTTCTCTGAGTGGG
>probe:Drosophila_2:1628676_at:310:531; Interrogation_Position=5357; Antisense; GGGTATTCGGAGTCCCAGCGATTAA
>probe:Drosophila_2:1628676_at:676:327; Interrogation_Position=5374; Antisense; GCGATTAACACCCAGCACAGCACAG
>probe:Drosophila_2:1628676_at:484:649; Interrogation_Position=5415; Antisense; TCACACCTTAGGACGAGAGCCGAAA
>probe:Drosophila_2:1628676_at:276:61; Interrogation_Position=5495; Antisense; ATGTAGAAGTGCGTGCCCATTTGTG
>probe:Drosophila_2:1628676_at:290:595; Interrogation_Position=5555; Antisense; TGTGCTATTGTCGTACGGGCGGAAA
>probe:Drosophila_2:1628676_at:163:125; Interrogation_Position=5606; Antisense; AGCCTGTGGAATTCGTGTGCGCAGC
>probe:Drosophila_2:1628676_at:357:639; Interrogation_Position=5618; Antisense; TCGTGTGCGCAGCAAACCGGAAGTT
>probe:Drosophila_2:1628676_at:599:373; Interrogation_Position=5637; Antisense; GAAGTTGCCAACGATAATGACATTA
>probe:Drosophila_2:1628676_at:612:463; Interrogation_Position=5679; Antisense; GATTGCTGTTTACGGCCATCACAAG

Paste this into a BLAST search page for me
TAAAGTCCTTTACCGTAATGTGCAAAATTGTTTTTCTTTCTCGCACGAAGCTGATCCTGCTTAATCTACCGTGAAATCGCCAGGCCTCTAAAGTTTTGTAAAACATCCGAGTTTCTCTGAGTGGGGGGTATTCGGAGTCCCAGCGATTAAGCGATTAACACCCAGCACAGCACAGTCACACCTTAGGACGAGAGCCGAAAATGTAGAAGTGCGTGCCCATTTGTGTGTGCTATTGTCGTACGGGCGGAAAAGCCTGTGGAATTCGTGTGCGCAGCTCGTGTGCGCAGCAAACCGGAAGTTGAAGTTGCCAACGATAATGACATTAGATTGCTGTTTACGGCCATCACAAG

Full Affymetrix probeset data:

Annotations for 1628676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime