Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628677_at:

>probe:Drosophila_2:1628677_at:462:433; Interrogation_Position=1360; Antisense; GAGGGACATGTTCGCATTGCCGATT
>probe:Drosophila_2:1628677_at:319:351; Interrogation_Position=1423; Antisense; GCAGATAGCTTTTGTGGCACACCCG
>probe:Drosophila_2:1628677_at:208:157; Interrogation_Position=1441; Antisense; ACACCCGATTATATGGCGCCCGAAA
>probe:Drosophila_2:1628677_at:627:533; Interrogation_Position=1513; Antisense; GGTGTGCTGCTCTACGAAATGCTAA
>probe:Drosophila_2:1628677_at:375:501; Interrogation_Position=1545; Antisense; GTCGCCATTCAGTGGCTGCGATGAA
>probe:Drosophila_2:1628677_at:235:213; Interrogation_Position=1568; Antisense; AAGACGAGCTCTTCTGGTCCATTTG
>probe:Drosophila_2:1628677_at:210:395; Interrogation_Position=1597; Antisense; GAAATTCCATGGTTCCCAGTTTACA
>probe:Drosophila_2:1628677_at:256:307; Interrogation_Position=1612; Antisense; CCAGTTTACATATCCGCCGAGGCAA
>probe:Drosophila_2:1628677_at:455:121; Interrogation_Position=1676; Antisense; AGCGTATTGGTTCGCAGTACAGCCC
>probe:Drosophila_2:1628677_at:334:27; Interrogation_Position=1711; Antisense; ATAGCCGATCATATATTCTTCCGCC
>probe:Drosophila_2:1628677_at:300:205; Interrogation_Position=1783; Antisense; AAGCCGCAAGTGAAACATCCCCTGG
>probe:Drosophila_2:1628677_at:128:717; Interrogation_Position=1819; Antisense; TTCGATCGGGTCTTCACCAGGGAAA
>probe:Drosophila_2:1628677_at:20:509; Interrogation_Position=1846; Antisense; GTGCGTCTAACACCCATCGATAAGG
>probe:Drosophila_2:1628677_at:169:165; Interrogation_Position=1920; Antisense; AAATCCTCACATCACCTTGGACTAG

Paste this into a BLAST search page for me
GAGGGACATGTTCGCATTGCCGATTGCAGATAGCTTTTGTGGCACACCCGACACCCGATTATATGGCGCCCGAAAGGTGTGCTGCTCTACGAAATGCTAAGTCGCCATTCAGTGGCTGCGATGAAAAGACGAGCTCTTCTGGTCCATTTGGAAATTCCATGGTTCCCAGTTTACACCAGTTTACATATCCGCCGAGGCAAAGCGTATTGGTTCGCAGTACAGCCCATAGCCGATCATATATTCTTCCGCCAAGCCGCAAGTGAAACATCCCCTGGTTCGATCGGGTCTTCACCAGGGAAAGTGCGTCTAACACCCATCGATAAGGAAATCCTCACATCACCTTGGACTAG

Full Affymetrix probeset data:

Annotations for 1628677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime