FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628678_at:

>probe:Drosophila_2:1628678_at:155:331; Interrogation_Position=1033; Antisense; GCGGGTCTCAAATTCATTCACATCA
>probe:Drosophila_2:1628678_at:70:163; Interrogation_Position=1071; Antisense; AAATTCATGTTTTCACTTTGGTGCC
>probe:Drosophila_2:1628678_at:399:485; Interrogation_Position=1158; Antisense; GTAGACGCGACCAGATCAAACCAGA
>probe:Drosophila_2:1628678_at:489:239; Interrogation_Position=1187; Antisense; AATCAAATCCTCTTCGTAACGGGCA
>probe:Drosophila_2:1628678_at:725:489; Interrogation_Position=1202; Antisense; GTAACGGGCACTTAGTCGGAACCAT
>probe:Drosophila_2:1628678_at:78:199; Interrogation_Position=737; Antisense; AACGTTACGCTGCTGGTGTTGATGC
>probe:Drosophila_2:1628678_at:204:595; Interrogation_Position=765; Antisense; TGGGCATCTACCAGCACTGGATGGT
>probe:Drosophila_2:1628678_at:723:439; Interrogation_Position=784; Antisense; GATGGTCAGTGATCCGTTCGAGCGC
>probe:Drosophila_2:1628678_at:400:537; Interrogation_Position=823; Antisense; GGTCTTCACCTTCATGCTGGGCGGA
>probe:Drosophila_2:1628678_at:36:403; Interrogation_Position=932; Antisense; GACTAGGTGCCTGCTACCGGTGCAT
>probe:Drosophila_2:1628678_at:620:289; Interrogation_Position=949; Antisense; CGGTGCATCACGTACTCATAGTCAT
>probe:Drosophila_2:1628678_at:574:645; Interrogation_Position=964; Antisense; TCATAGTCATTCACTGATCCAGCTT
>probe:Drosophila_2:1628678_at:658:447; Interrogation_Position=979; Antisense; GATCCAGCTTTGTTTTAGCACCTTA
>probe:Drosophila_2:1628678_at:282:351; Interrogation_Position=996; Antisense; GCACCTTAAGTTGGGCTCGAGATGG

Paste this into a BLAST search page for me
GCGGGTCTCAAATTCATTCACATCAAAATTCATGTTTTCACTTTGGTGCCGTAGACGCGACCAGATCAAACCAGAAATCAAATCCTCTTCGTAACGGGCAGTAACGGGCACTTAGTCGGAACCATAACGTTACGCTGCTGGTGTTGATGCTGGGCATCTACCAGCACTGGATGGTGATGGTCAGTGATCCGTTCGAGCGCGGTCTTCACCTTCATGCTGGGCGGAGACTAGGTGCCTGCTACCGGTGCATCGGTGCATCACGTACTCATAGTCATTCATAGTCATTCACTGATCCAGCTTGATCCAGCTTTGTTTTAGCACCTTAGCACCTTAAGTTGGGCTCGAGATGG

Full Affymetrix probeset data:

Annotations for 1628678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720