Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628679_at:

>probe:Drosophila_2:1628679_at:624:549; Interrogation_Position=2007; Antisense; GGAGTCCGTGGTGCCAACGAATCAT
>probe:Drosophila_2:1628679_at:358:491; Interrogation_Position=2032; Antisense; GTAACTATTATATCCGACACTCCGG
>probe:Drosophila_2:1628679_at:569:129; Interrogation_Position=2050; Antisense; ACTCCGGAAGAGTGTTTTCAAACTG
>probe:Drosophila_2:1628679_at:446:707; Interrogation_Position=2090; Antisense; TTAAAAACGAGCCTCTGGCACCGGA
>probe:Drosophila_2:1628679_at:113:559; Interrogation_Position=2112; Antisense; GGACACGTCACCGAATTCTGAAATA
>probe:Drosophila_2:1628679_at:621:677; Interrogation_Position=2135; Antisense; TAGTTGCACAACTCAATGCGATGGA
>probe:Drosophila_2:1628679_at:284:389; Interrogation_Position=2197; Antisense; GAAACTATCGCACCTGATGCAGTCC
>probe:Drosophila_2:1628679_at:655:605; Interrogation_Position=2211; Antisense; TGATGCAGTCCTCATACCTCGTGTC
>probe:Drosophila_2:1628679_at:366:671; Interrogation_Position=2225; Antisense; TACCTCGTGTCCCAACGGAAGATAC
>probe:Drosophila_2:1628679_at:305:183; Interrogation_Position=2287; Antisense; AAAAGCCAGGCAGTCGTGGTTAGTA
>probe:Drosophila_2:1628679_at:399:475; Interrogation_Position=2305; Antisense; GTTAGTAGACTGACATCCGATGCAT
>probe:Drosophila_2:1628679_at:402:47; Interrogation_Position=2319; Antisense; ATCCGATGCATCAGACGATTGGCTC
>probe:Drosophila_2:1628679_at:296:409; Interrogation_Position=2332; Antisense; GACGATTGGCTCCTGTAGTGATTAA
>probe:Drosophila_2:1628679_at:436:255; Interrogation_Position=2565; Antisense; CACACTATTTAGTTGCGAACCGTAC

Paste this into a BLAST search page for me
GGAGTCCGTGGTGCCAACGAATCATGTAACTATTATATCCGACACTCCGGACTCCGGAAGAGTGTTTTCAAACTGTTAAAAACGAGCCTCTGGCACCGGAGGACACGTCACCGAATTCTGAAATATAGTTGCACAACTCAATGCGATGGAGAAACTATCGCACCTGATGCAGTCCTGATGCAGTCCTCATACCTCGTGTCTACCTCGTGTCCCAACGGAAGATACAAAAGCCAGGCAGTCGTGGTTAGTAGTTAGTAGACTGACATCCGATGCATATCCGATGCATCAGACGATTGGCTCGACGATTGGCTCCTGTAGTGATTAACACACTATTTAGTTGCGAACCGTAC

Full Affymetrix probeset data:

Annotations for 1628679_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime