FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628680_at:

>probe:Drosophila_2:1628680_at:71:663; Interrogation_Position=324; Antisense; TAAAGTCCAGTGTGGGTGCTACTCC
>probe:Drosophila_2:1628680_at:342:49; Interrogation_Position=367; Antisense; AGGCTCTGGAGCCACTAGGAACACT
>probe:Drosophila_2:1628680_at:14:89; Interrogation_Position=398; Antisense; AGTAGGACCCAGCACTTTTGCATTC
>probe:Drosophila_2:1628680_at:358:507; Interrogation_Position=425; Antisense; GTGCGGAGCTGTTATACTGTGACCA
>probe:Drosophila_2:1628680_at:658:359; Interrogation_Position=522; Antisense; GCAAGAGCGCGGTGGATCCCATGAA
>probe:Drosophila_2:1628680_at:25:383; Interrogation_Position=617; Antisense; GAACGCAGCCCAGACGACAAGTACA
>probe:Drosophila_2:1628680_at:9:217; Interrogation_Position=635; Antisense; AAGTACAACTATCCGGAGGCCACCA
>probe:Drosophila_2:1628680_at:552:119; Interrogation_Position=659; Antisense; AGCTGGCGATATGGGTGGTTCCACC
>probe:Drosophila_2:1628680_at:634:427; Interrogation_Position=686; Antisense; GAGTCAGATCTCCTGCAGAAGCGCG
>probe:Drosophila_2:1628680_at:323:205; Interrogation_Position=704; Antisense; AAGCGCGTGCCCAGGCGAGATTAGA
>probe:Drosophila_2:1628680_at:102:677; Interrogation_Position=725; Antisense; TAGAACAGCATTTCGTCCTGTCCTG
>probe:Drosophila_2:1628680_at:88:307; Interrogation_Position=741; Antisense; CCTGTCCTGCCCAATTTCAATGAAA
>probe:Drosophila_2:1628680_at:693:393; Interrogation_Position=762; Antisense; GAAATGCTTCTATCCACAGAGGCCT
>probe:Drosophila_2:1628680_at:415:233; Interrogation_Position=805; Antisense; AATGCGTACCTCTTGCTTTTCAATA

Paste this into a BLAST search page for me
TAAAGTCCAGTGTGGGTGCTACTCCAGGCTCTGGAGCCACTAGGAACACTAGTAGGACCCAGCACTTTTGCATTCGTGCGGAGCTGTTATACTGTGACCAGCAAGAGCGCGGTGGATCCCATGAAGAACGCAGCCCAGACGACAAGTACAAAGTACAACTATCCGGAGGCCACCAAGCTGGCGATATGGGTGGTTCCACCGAGTCAGATCTCCTGCAGAAGCGCGAAGCGCGTGCCCAGGCGAGATTAGATAGAACAGCATTTCGTCCTGTCCTGCCTGTCCTGCCCAATTTCAATGAAAGAAATGCTTCTATCCACAGAGGCCTAATGCGTACCTCTTGCTTTTCAATA

Full Affymetrix probeset data:

Annotations for 1628680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720