FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628681_at:

>probe:Drosophila_2:1628681_at:524:139; Interrogation_Position=321; Antisense; ACGGGTCCGATTTTGGACTGGTGCT
>probe:Drosophila_2:1628681_at:151:143; Interrogation_Position=337; Antisense; ACTGGTGCTGTCTGTGGTCACCAAA
>probe:Drosophila_2:1628681_at:36:595; Interrogation_Position=364; Antisense; TGGGCTGCCAGCAATTGGCCGGAAT
>probe:Drosophila_2:1628681_at:22:319; Interrogation_Position=381; Antisense; GCCGGAATCTACTACCAAAACCAAT
>probe:Drosophila_2:1628681_at:213:175; Interrogation_Position=398; Antisense; AAACCAATCGCGCTGGAGGGACACC
>probe:Drosophila_2:1628681_at:654:527; Interrogation_Position=415; Antisense; GGGACACCTGCGAAATTTGTCTGCA
>probe:Drosophila_2:1628681_at:613:163; Interrogation_Position=427; Antisense; AAATTTGTCTGCACTCCTGCATCTG
>probe:Drosophila_2:1628681_at:173:595; Interrogation_Position=520; Antisense; TGGGCATCCTGCTGTCGAGGTCTTA
>probe:Drosophila_2:1628681_at:120:501; Interrogation_Position=533; Antisense; GTCGAGGTCTTATCTATGGTCTTGA
>probe:Drosophila_2:1628681_at:129:625; Interrogation_Position=560; Antisense; TGCGCTGCTTTGCATATCACTGGAA
>probe:Drosophila_2:1628681_at:518:245; Interrogation_Position=584; Antisense; AATTCAATAAGGTTGCCTGCATGGG
>probe:Drosophila_2:1628681_at:725:431; Interrogation_Position=617; Antisense; GAGTGGCCGGGCACATACCGAAAAA
>probe:Drosophila_2:1628681_at:293:577; Interrogation_Position=648; Antisense; GGCCATTGCACTTAGCCAAGTCGAA
>probe:Drosophila_2:1628681_at:243:529; Interrogation_Position=743; Antisense; GGGAGCCGTGGCATATCATATTGTT

Paste this into a BLAST search page for me
ACGGGTCCGATTTTGGACTGGTGCTACTGGTGCTGTCTGTGGTCACCAAATGGGCTGCCAGCAATTGGCCGGAATGCCGGAATCTACTACCAAAACCAATAAACCAATCGCGCTGGAGGGACACCGGGACACCTGCGAAATTTGTCTGCAAAATTTGTCTGCACTCCTGCATCTGTGGGCATCCTGCTGTCGAGGTCTTAGTCGAGGTCTTATCTATGGTCTTGATGCGCTGCTTTGCATATCACTGGAAAATTCAATAAGGTTGCCTGCATGGGGAGTGGCCGGGCACATACCGAAAAAGGCCATTGCACTTAGCCAAGTCGAAGGGAGCCGTGGCATATCATATTGTT

Full Affymetrix probeset data:

Annotations for 1628681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720