FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628682_at:

>probe:Drosophila_2:1628682_at:626:385; Interrogation_Position=449; Antisense; GAACAGATGAACTGCCTCCGGGCGA
>probe:Drosophila_2:1628682_at:271:169; Interrogation_Position=475; Antisense; AAATGGCCGGACTTTGTGACACGCG
>probe:Drosophila_2:1628682_at:712:509; Interrogation_Position=490; Antisense; GTGACACGCGAGTTTGGGAACCCAG
>probe:Drosophila_2:1628682_at:317:707; Interrogation_Position=563; Antisense; TTAGCTACTGCAAGATGGCGCGCGC
>probe:Drosophila_2:1628682_at:401:201; Interrogation_Position=634; Antisense; AACCGGGATGCCGTGCACAAGTATC
>probe:Drosophila_2:1628682_at:17:61; Interrogation_Position=708; Antisense; ATGTTCGGAGCGTGAAGCCCTCGAG
>probe:Drosophila_2:1628682_at:61:165; Interrogation_Position=744; Antisense; AAATCCATTGGTCCTTGAGCCCTTT
>probe:Drosophila_2:1628682_at:137:401; Interrogation_Position=782; Antisense; GACTACGTACCGAGCGAACGCTTAT
>probe:Drosophila_2:1628682_at:634:133; Interrogation_Position=799; Antisense; ACGCTTATGATTGGTGACTGCCTCA
>probe:Drosophila_2:1628682_at:570:163; Interrogation_Position=824; Antisense; AAATAGATGTCGGTTTCGCCAGCAA
>probe:Drosophila_2:1628682_at:283:249; Interrogation_Position=847; Antisense; AATTGTGGCATGCTATCGCTTCTGG
>probe:Drosophila_2:1628682_at:65:567; Interrogation_Position=874; Antisense; GGCACGGGTCGTTACAATAATCTCT
>probe:Drosophila_2:1628682_at:584:37; Interrogation_Position=893; Antisense; ATCTCTCGGATGTCCGGCTGGAAAA
>probe:Drosophila_2:1628682_at:204:31; Interrogation_Position=985; Antisense; ATAAATCCATGGGACTCTCGCGCAG

Paste this into a BLAST search page for me
GAACAGATGAACTGCCTCCGGGCGAAAATGGCCGGACTTTGTGACACGCGGTGACACGCGAGTTTGGGAACCCAGTTAGCTACTGCAAGATGGCGCGCGCAACCGGGATGCCGTGCACAAGTATCATGTTCGGAGCGTGAAGCCCTCGAGAAATCCATTGGTCCTTGAGCCCTTTGACTACGTACCGAGCGAACGCTTATACGCTTATGATTGGTGACTGCCTCAAAATAGATGTCGGTTTCGCCAGCAAAATTGTGGCATGCTATCGCTTCTGGGGCACGGGTCGTTACAATAATCTCTATCTCTCGGATGTCCGGCTGGAAAAATAAATCCATGGGACTCTCGCGCAG

Full Affymetrix probeset data:

Annotations for 1628682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720