FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628683_at:

>probe:Drosophila_2:1628683_at:512:675; Interrogation_Position=130; Antisense; TAGCGATTCGCCATTAAGTCCGCAC
>probe:Drosophila_2:1628683_at:451:593; Interrogation_Position=14; Antisense; TGTGTTTTCTTCTGCATTTCCGTCC
>probe:Drosophila_2:1628683_at:335:711; Interrogation_Position=143; Antisense; TTAAGTCCGCACACAGACGATCCAG
>probe:Drosophila_2:1628683_at:232:573; Interrogation_Position=199; Antisense; GGCTGTTCAGCGCACACGCGAAAAG
>probe:Drosophila_2:1628683_at:6:177; Interrogation_Position=277; Antisense; AAACGATGCTCTTAAGGTTCAGATC
>probe:Drosophila_2:1628683_at:462:17; Interrogation_Position=29; Antisense; ATTTCCGTCCGATTGCGATCCAATT
>probe:Drosophila_2:1628683_at:174:643; Interrogation_Position=323; Antisense; TCTACGCTTAGAGATCTGATCATTC
>probe:Drosophila_2:1628683_at:492:407; Interrogation_Position=365; Antisense; GACGGCCATCGAATCATCCAGGAGA
>probe:Drosophila_2:1628683_at:87:77; Interrogation_Position=384; Antisense; AGGAGATTCTCGCTGAACCAGATCC
>probe:Drosophila_2:1628683_at:321:397; Interrogation_Position=419; Antisense; GACAATGACTAACGAGGAGCTTCTC
>probe:Drosophila_2:1628683_at:700:115; Interrogation_Position=436; Antisense; AGCTTCTCCTGATTTACCTTCTTAT
>probe:Drosophila_2:1628683_at:55:127; Interrogation_Position=476; Antisense; AGCCATTTCCCATGGTTGTTAACCA
>probe:Drosophila_2:1628683_at:578:229; Interrogation_Position=528; Antisense; AATGGTGCAATTGCTCGAATTCTAT
>probe:Drosophila_2:1628683_at:405:181; Interrogation_Position=98; Antisense; AAAAAGAGAACTGCCGCGTCGACCA

Paste this into a BLAST search page for me
TAGCGATTCGCCATTAAGTCCGCACTGTGTTTTCTTCTGCATTTCCGTCCTTAAGTCCGCACACAGACGATCCAGGGCTGTTCAGCGCACACGCGAAAAGAAACGATGCTCTTAAGGTTCAGATCATTTCCGTCCGATTGCGATCCAATTTCTACGCTTAGAGATCTGATCATTCGACGGCCATCGAATCATCCAGGAGAAGGAGATTCTCGCTGAACCAGATCCGACAATGACTAACGAGGAGCTTCTCAGCTTCTCCTGATTTACCTTCTTATAGCCATTTCCCATGGTTGTTAACCAAATGGTGCAATTGCTCGAATTCTATAAAAAGAGAACTGCCGCGTCGACCA

Full Affymetrix probeset data:

Annotations for 1628683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720