FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628684_at:

>probe:Drosophila_2:1628684_at:383:557; Interrogation_Position=2185; Antisense; GGACATAGACAGACACACATAAATT
>probe:Drosophila_2:1628684_at:168:5; Interrogation_Position=2214; Antisense; ATTGATCCAACTGAATAATTCCTAA
>probe:Drosophila_2:1628684_at:499:25; Interrogation_Position=2271; Antisense; ATGATTTTTAAACCAGCCGACCGCG
>probe:Drosophila_2:1628684_at:534:317; Interrogation_Position=2286; Antisense; GCCGACCGCGGAGGAGAAACCAACA
>probe:Drosophila_2:1628684_at:424:391; Interrogation_Position=2301; Antisense; GAAACCAACAGAAGTGTTAATCGGT
>probe:Drosophila_2:1628684_at:700:677; Interrogation_Position=2334; Antisense; TAGATCGAAGTCTAGTTTTAAGCTG
>probe:Drosophila_2:1628684_at:713:285; Interrogation_Position=2356; Antisense; CTGTGGCAGTGGCAAATGTATTTGT
>probe:Drosophila_2:1628684_at:612:59; Interrogation_Position=2371; Antisense; ATGTATTTGTATCTCTAGCCGCGTA
>probe:Drosophila_2:1628684_at:356:643; Interrogation_Position=2382; Antisense; TCTCTAGCCGCGTATGCAACATATA
>probe:Drosophila_2:1628684_at:628:599; Interrogation_Position=2421; Antisense; TGTATGTATGTGTCTGTACGAATAA
>probe:Drosophila_2:1628684_at:716:499; Interrogation_Position=2432; Antisense; GTCTGTACGAATAAACCATATGCGA
>probe:Drosophila_2:1628684_at:521:189; Interrogation_Position=2626; Antisense; AACGTTAAGTGTACAATTTTGCATT
>probe:Drosophila_2:1628684_at:583:29; Interrogation_Position=2692; Antisense; ATAAAATGTTCAGCTAATCACATGG
>probe:Drosophila_2:1628684_at:376:569; Interrogation_Position=2714; Antisense; TGGAAAGCAAAAGCAACCCAAACTA

Paste this into a BLAST search page for me
GGACATAGACAGACACACATAAATTATTGATCCAACTGAATAATTCCTAAATGATTTTTAAACCAGCCGACCGCGGCCGACCGCGGAGGAGAAACCAACAGAAACCAACAGAAGTGTTAATCGGTTAGATCGAAGTCTAGTTTTAAGCTGCTGTGGCAGTGGCAAATGTATTTGTATGTATTTGTATCTCTAGCCGCGTATCTCTAGCCGCGTATGCAACATATATGTATGTATGTGTCTGTACGAATAAGTCTGTACGAATAAACCATATGCGAAACGTTAAGTGTACAATTTTGCATTATAAAATGTTCAGCTAATCACATGGTGGAAAGCAAAAGCAACCCAAACTA

Full Affymetrix probeset data:

Annotations for 1628684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720