Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628688_at:

>probe:Drosophila_2:1628688_at:399:247; Interrogation_Position=2552; Antisense; AATTGACCAGCTTGTCCGTATACGA
>probe:Drosophila_2:1628688_at:389:405; Interrogation_Position=2588; Antisense; GACTCGACAGAATGCCGATCTTCTT
>probe:Drosophila_2:1628688_at:240:561; Interrogation_Position=2653; Antisense; GGAAACATTTCGTAGACTGCTTACT
>probe:Drosophila_2:1628688_at:445:401; Interrogation_Position=2667; Antisense; GACTGCTTACTTGTTCTTAGTTTAG
>probe:Drosophila_2:1628688_at:390:103; Interrogation_Position=2690; Antisense; AGACTTCGAGTCCAATCAATTGTAT
>probe:Drosophila_2:1628688_at:469:559; Interrogation_Position=2733; Antisense; GGAAACAATCCCACAAATCGCATTA
>probe:Drosophila_2:1628688_at:648:483; Interrogation_Position=2824; Antisense; GTATGACTTTCATGCTTGTATTAAA
>probe:Drosophila_2:1628688_at:544:147; Interrogation_Position=2848; Antisense; ACTATTTACAACTGCTGATCTCCTC
>probe:Drosophila_2:1628688_at:126:145; Interrogation_Position=2858; Antisense; ACTGCTGATCTCCTCTTAATTTAAT
>probe:Drosophila_2:1628688_at:696:187; Interrogation_Position=2902; Antisense; AACACCAACACAGACGAAGCACGAG
>probe:Drosophila_2:1628688_at:638:711; Interrogation_Position=2967; Antisense; TTCATTTCCAACTGATCACTTTAAT
>probe:Drosophila_2:1628688_at:36:473; Interrogation_Position=2996; Antisense; GTTAGCATTACCACTTAGAACTTTT
>probe:Drosophila_2:1628688_at:547:655; Interrogation_Position=3022; Antisense; TAATCTCGGCTTTAGCTTTAGTGAC
>probe:Drosophila_2:1628688_at:716:341; Interrogation_Position=3036; Antisense; GCTTTAGTGACTATTCGTATTCGAC

Paste this into a BLAST search page for me
AATTGACCAGCTTGTCCGTATACGAGACTCGACAGAATGCCGATCTTCTTGGAAACATTTCGTAGACTGCTTACTGACTGCTTACTTGTTCTTAGTTTAGAGACTTCGAGTCCAATCAATTGTATGGAAACAATCCCACAAATCGCATTAGTATGACTTTCATGCTTGTATTAAAACTATTTACAACTGCTGATCTCCTCACTGCTGATCTCCTCTTAATTTAATAACACCAACACAGACGAAGCACGAGTTCATTTCCAACTGATCACTTTAATGTTAGCATTACCACTTAGAACTTTTTAATCTCGGCTTTAGCTTTAGTGACGCTTTAGTGACTATTCGTATTCGAC

Full Affymetrix probeset data:

Annotations for 1628688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime