Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628689_at:

>probe:Drosophila_2:1628689_at:495:433; Interrogation_Position=3525; Antisense; GAGTGGCACGCGACGCCAGAGTACA
>probe:Drosophila_2:1628689_at:378:309; Interrogation_Position=3571; Antisense; CCAGCAGCGACATCAACGGCATCAA
>probe:Drosophila_2:1628689_at:423:551; Interrogation_Position=3632; Antisense; GGAGCACTCTGCATCCATTTTTAAA
>probe:Drosophila_2:1628689_at:447:345; Interrogation_Position=3642; Antisense; GCATCCATTTTTAAACTCACCGTTC
>probe:Drosophila_2:1628689_at:124:121; Interrogation_Position=3660; Antisense; ACCGTTCGACAAATTACCCTTCATG
>probe:Drosophila_2:1628689_at:421:13; Interrogation_Position=3672; Antisense; ATTACCCTTCATGGATACCAGCTAT
>probe:Drosophila_2:1628689_at:356:113; Interrogation_Position=3828; Antisense; AGCAGCGTCATCATCCCCGGAGGAT
>probe:Drosophila_2:1628689_at:275:301; Interrogation_Position=3843; Antisense; CCCGGAGGATGTGCACCAGGATTCA
>probe:Drosophila_2:1628689_at:431:11; Interrogation_Position=3863; Antisense; ATTCAGGTTCTGGTTCGGTTGAGCG
>probe:Drosophila_2:1628689_at:476:327; Interrogation_Position=3926; Antisense; GCGATGATCCGCTTGGTCAGTTGAA
>probe:Drosophila_2:1628689_at:637:579; Interrogation_Position=3953; Antisense; TGGCTGGCTGCAACATATACGGACG
>probe:Drosophila_2:1628689_at:99:691; Interrogation_Position=3999; Antisense; TATTGTGGAGCTATCCAGCCAGTGC
>probe:Drosophila_2:1628689_at:405:127; Interrogation_Position=4015; Antisense; AGCCAGTGCCTGGAATGCAAATGCA
>probe:Drosophila_2:1628689_at:459:651; Interrogation_Position=4052; Antisense; TCAAGTGCGGCCCATTAGACTGTTA

Paste this into a BLAST search page for me
GAGTGGCACGCGACGCCAGAGTACACCAGCAGCGACATCAACGGCATCAAGGAGCACTCTGCATCCATTTTTAAAGCATCCATTTTTAAACTCACCGTTCACCGTTCGACAAATTACCCTTCATGATTACCCTTCATGGATACCAGCTATAGCAGCGTCATCATCCCCGGAGGATCCCGGAGGATGTGCACCAGGATTCAATTCAGGTTCTGGTTCGGTTGAGCGGCGATGATCCGCTTGGTCAGTTGAATGGCTGGCTGCAACATATACGGACGTATTGTGGAGCTATCCAGCCAGTGCAGCCAGTGCCTGGAATGCAAATGCATCAAGTGCGGCCCATTAGACTGTTA

Full Affymetrix probeset data:

Annotations for 1628689_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime