FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628690_at:

>probe:Drosophila_2:1628690_at:635:413; Interrogation_Position=1005; Antisense; GACCACGTTGCGGACTATGTAGCCA
>probe:Drosophila_2:1628690_at:409:681; Interrogation_Position=1020; Antisense; TATGTAGCCAGATGCGGATACGCCA
>probe:Drosophila_2:1628690_at:385:45; Interrogation_Position=1059; Antisense; ATCGCCGTAGACCAAATCGCAGCAA
>probe:Drosophila_2:1628690_at:728:605; Interrogation_Position=1105; Antisense; TGATCCAGTCGCTCGGCGGGATTCT
>probe:Drosophila_2:1628690_at:141:679; Interrogation_Position=1173; Antisense; TTGCGACCCTACATTCGTTTGCTTT
>probe:Drosophila_2:1628690_at:333:299; Interrogation_Position=666; Antisense; CGCCACATGAATATGCGCCAGTTGT
>probe:Drosophila_2:1628690_at:162:413; Interrogation_Position=705; Antisense; GACCGCCGTCTCAACGAGAAACAGT
>probe:Drosophila_2:1628690_at:327:555; Interrogation_Position=768; Antisense; GGACACTGGTCCCTACTGGTGATTT
>probe:Drosophila_2:1628690_at:249:695; Interrogation_Position=790; Antisense; TTTCGCGGCCGGACAGCAAGTTTTA
>probe:Drosophila_2:1628690_at:525:213; Interrogation_Position=805; Antisense; GCAAGTTTTACCACTACGATTCGTT
>probe:Drosophila_2:1628690_at:162:467; Interrogation_Position=827; Antisense; GTTGGACAACTGTCATTCGCCGTTG
>probe:Drosophila_2:1628690_at:253:727; Interrogation_Position=849; Antisense; TTGGCCGCCTCGGTGTCGGAAACTT
>probe:Drosophila_2:1628690_at:323:347; Interrogation_Position=975; Antisense; GCATCCGGAATTCACCTGATGTGCA
>probe:Drosophila_2:1628690_at:72:607; Interrogation_Position=991; Antisense; TGATGTGCATGACCGACCACGTTGC

Paste this into a BLAST search page for me
GACCACGTTGCGGACTATGTAGCCATATGTAGCCAGATGCGGATACGCCAATCGCCGTAGACCAAATCGCAGCAATGATCCAGTCGCTCGGCGGGATTCTTTGCGACCCTACATTCGTTTGCTTTCGCCACATGAATATGCGCCAGTTGTGACCGCCGTCTCAACGAGAAACAGTGGACACTGGTCCCTACTGGTGATTTTTTCGCGGCCGGACAGCAAGTTTTAGCAAGTTTTACCACTACGATTCGTTGTTGGACAACTGTCATTCGCCGTTGTTGGCCGCCTCGGTGTCGGAAACTTGCATCCGGAATTCACCTGATGTGCATGATGTGCATGACCGACCACGTTGC

Full Affymetrix probeset data:

Annotations for 1628690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720