FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628691_at:

>probe:Drosophila_2:1628691_at:447:389; Interrogation_Position=7485; Antisense; GAAAAAGTGCCAATTGCCTCCAATG
>probe:Drosophila_2:1628691_at:552:721; Interrogation_Position=7498; Antisense; TTGCCTCCAATGCTGTAAGAGCTGC
>probe:Drosophila_2:1628691_at:330:657; Interrogation_Position=7513; Antisense; TAAGAGCTGCCACTTACCTTTTGGA
>probe:Drosophila_2:1628691_at:72:673; Interrogation_Position=7527; Antisense; TACCTTTTGGACTATTACCTTGTCA
>probe:Drosophila_2:1628691_at:40:491; Interrogation_Position=7577; Antisense; TGTAATGGCGTTATCTAGGGCAATG
>probe:Drosophila_2:1628691_at:709:439; Interrogation_Position=7617; Antisense; GATGTTAAACAGCTTGTTGCACAAA
>probe:Drosophila_2:1628691_at:329:465; Interrogation_Position=7632; Antisense; GTTGCACAAAGTTGTACCTACCTTT
>probe:Drosophila_2:1628691_at:327:243; Interrogation_Position=7699; Antisense; AATATTTGGTGCCTATGCTGGTAAA
>probe:Drosophila_2:1628691_at:11:97; Interrogation_Position=7794; Antisense; AGATCTGACGATACGAGCTTTTTAA
>probe:Drosophila_2:1628691_at:544:711; Interrogation_Position=7823; Antisense; TTCAGGTCTGTTAGAATCTGGTGCT
>probe:Drosophila_2:1628691_at:301:367; Interrogation_Position=7836; Antisense; GAATCTGGTGCTAGAGACTCATTAA
>probe:Drosophila_2:1628691_at:206:183; Interrogation_Position=7883; Antisense; AAAACGCACATCTTCACAATCTATT
>probe:Drosophila_2:1628691_at:708:107; Interrogation_Position=7916; Antisense; AGAAGAATTGGATGACACTCTGCAA
>probe:Drosophila_2:1628691_at:111:399; Interrogation_Position=7929; Antisense; GACACTCTGCAATCATAACCAATTT

Paste this into a BLAST search page for me
GAAAAAGTGCCAATTGCCTCCAATGTTGCCTCCAATGCTGTAAGAGCTGCTAAGAGCTGCCACTTACCTTTTGGATACCTTTTGGACTATTACCTTGTCATGTAATGGCGTTATCTAGGGCAATGGATGTTAAACAGCTTGTTGCACAAAGTTGCACAAAGTTGTACCTACCTTTAATATTTGGTGCCTATGCTGGTAAAAGATCTGACGATACGAGCTTTTTAATTCAGGTCTGTTAGAATCTGGTGCTGAATCTGGTGCTAGAGACTCATTAAAAAACGCACATCTTCACAATCTATTAGAAGAATTGGATGACACTCTGCAAGACACTCTGCAATCATAACCAATTT

Full Affymetrix probeset data:

Annotations for 1628691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720