FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628693_at:

>probe:Drosophila_2:1628693_at:462:221; Interrogation_Position=361; Antisense; AAGTGGCCATATCGGAGTTTTGCAA
>probe:Drosophila_2:1628693_at:174:555; Interrogation_Position=403; Antisense; GGAGCCAGGATCCATTCTATCACAT
>probe:Drosophila_2:1628693_at:141:683; Interrogation_Position=420; Antisense; TATCACATCGGCACGGTCACAAAGC
>probe:Drosophila_2:1628693_at:633:121; Interrogation_Position=442; Antisense; AGCGTGCACGGCTTATACGAATTGT
>probe:Drosophila_2:1628693_at:284:577; Interrogation_Position=479; Antisense; GGCGCAGACACAATACATGACCGTT
>probe:Drosophila_2:1628693_at:42:199; Interrogation_Position=507; Antisense; AACGAGGACAGCATCTACGACATTC
>probe:Drosophila_2:1628693_at:243:263; Interrogation_Position=546; Antisense; CAGCGATACAATCACCATGCAGGCA
>probe:Drosophila_2:1628693_at:651:269; Interrogation_Position=561; Antisense; CATGCAGGCAGCTACGAGTGGCGAA
>probe:Drosophila_2:1628693_at:255:285; Interrogation_Position=618; Antisense; CTGAACTTGAATGGCACCCTGGACG
>probe:Drosophila_2:1628693_at:588:709; Interrogation_Position=692; Antisense; TTCAATTTGGCTCTACTACACGGAC
>probe:Drosophila_2:1628693_at:147:453; Interrogation_Position=733; Antisense; GATCTTGATTACTATTCTCCATATG
>probe:Drosophila_2:1628693_at:166:541; Interrogation_Position=822; Antisense; GGTTGTTCGCGTAGTTTACAGGCAT
>probe:Drosophila_2:1628693_at:320:497; Interrogation_Position=868; Antisense; GTCATGGTCCACAGCAGGCGGTAAT
>probe:Drosophila_2:1628693_at:647:113; Interrogation_Position=908; Antisense; AGCAGACTTGTTCAGGGTCGCACTG

Paste this into a BLAST search page for me
AAGTGGCCATATCGGAGTTTTGCAAGGAGCCAGGATCCATTCTATCACATTATCACATCGGCACGGTCACAAAGCAGCGTGCACGGCTTATACGAATTGTGGCGCAGACACAATACATGACCGTTAACGAGGACAGCATCTACGACATTCCAGCGATACAATCACCATGCAGGCACATGCAGGCAGCTACGAGTGGCGAACTGAACTTGAATGGCACCCTGGACGTTCAATTTGGCTCTACTACACGGACGATCTTGATTACTATTCTCCATATGGGTTGTTCGCGTAGTTTACAGGCATGTCATGGTCCACAGCAGGCGGTAATAGCAGACTTGTTCAGGGTCGCACTG

Full Affymetrix probeset data:

Annotations for 1628693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720