FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628695_at:

>probe:Drosophila_2:1628695_at:165:635; Interrogation_Position=1102; Antisense; TCGAATCAGAGCTCCCAACAGAGTT
>probe:Drosophila_2:1628695_at:52:501; Interrogation_Position=1182; Antisense; GTCGGTGAGCTATCAGAGCCTGAAT
>probe:Drosophila_2:1628695_at:576:623; Interrogation_Position=1206; Antisense; TGCCCAGAATCTGTTCGTTTCGATT
>probe:Drosophila_2:1628695_at:238:619; Interrogation_Position=1238; Antisense; TGCAGGAGCTAACGCGTCAGATCAA
>probe:Drosophila_2:1628695_at:704:97; Interrogation_Position=1286; Antisense; AGATCGATCTGGAGTACTGCGCGCA
>probe:Drosophila_2:1628695_at:127:325; Interrogation_Position=1306; Antisense; GCGCATCGCGATCAATTGAGACCCA
>probe:Drosophila_2:1628695_at:109:725; Interrogation_Position=1321; Antisense; TTGAGACCCAGTGAACGCAGGATCA
>probe:Drosophila_2:1628695_at:258:287; Interrogation_Position=1413; Antisense; CTGGCACGGCATGAAGCACTGGCTG
>probe:Drosophila_2:1628695_at:474:577; Interrogation_Position=1497; Antisense; GGCCCAATCACGGAGCAATCTTAAC
>probe:Drosophila_2:1628695_at:66:661; Interrogation_Position=1518; Antisense; TAACCAGTCAACTGCGGATGCCAGT
>probe:Drosophila_2:1628695_at:36:89; Interrogation_Position=1540; Antisense; AGTCGCCAGTCAATGTCGCCGGAAC
>probe:Drosophila_2:1628695_at:88:437; Interrogation_Position=1594; Antisense; GAGGATGTCACCGAACGCACCGAAA
>probe:Drosophila_2:1628695_at:248:589; Interrogation_Position=1619; Antisense; TGGAGTCGTCCATGTCGCACCGAAA
>probe:Drosophila_2:1628695_at:331:437; Interrogation_Position=1648; Antisense; GAGGAGGATCTGTCGCCGCATGCCA

Paste this into a BLAST search page for me
TCGAATCAGAGCTCCCAACAGAGTTGTCGGTGAGCTATCAGAGCCTGAATTGCCCAGAATCTGTTCGTTTCGATTTGCAGGAGCTAACGCGTCAGATCAAAGATCGATCTGGAGTACTGCGCGCAGCGCATCGCGATCAATTGAGACCCATTGAGACCCAGTGAACGCAGGATCACTGGCACGGCATGAAGCACTGGCTGGGCCCAATCACGGAGCAATCTTAACTAACCAGTCAACTGCGGATGCCAGTAGTCGCCAGTCAATGTCGCCGGAACGAGGATGTCACCGAACGCACCGAAATGGAGTCGTCCATGTCGCACCGAAAGAGGAGGATCTGTCGCCGCATGCCA

Full Affymetrix probeset data:

Annotations for 1628695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720