FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628696_at:

>probe:Drosophila_2:1628696_at:14:103; Interrogation_Position=1012; Antisense; AGAGCAAATAAACGCACGACGCATT
>probe:Drosophila_2:1628696_at:101:257; Interrogation_Position=460; Antisense; CACACAATCAGCCATCACCTGTAAT
>probe:Drosophila_2:1628696_at:151:35; Interrogation_Position=473; Antisense; ATCACCTGTAATCAGCCACTTCAAT
>probe:Drosophila_2:1628696_at:133:127; Interrogation_Position=486; Antisense; AGCCACTTCAATAGAGGACGCACTT
>probe:Drosophila_2:1628696_at:642:677; Interrogation_Position=497; Antisense; TAGAGGACGCACTTGGAGAGCCAAT
>probe:Drosophila_2:1628696_at:214:35; Interrogation_Position=545; Antisense; ATCACCGAACACAGTTTTGAATTCA
>probe:Drosophila_2:1628696_at:574:423; Interrogation_Position=571; Antisense; GAGACAAACACATGTTTCCTTTATC
>probe:Drosophila_2:1628696_at:609:255; Interrogation_Position=595; Antisense; CAAACCATTTTTTCTGTGCTGCTAC
>probe:Drosophila_2:1628696_at:141:509; Interrogation_Position=610; Antisense; GTGCTGCTACTCATATTTTTCTATT
>probe:Drosophila_2:1628696_at:400:347; Interrogation_Position=733; Antisense; GCACCATTGGTCTACTAAAAGCAGG
>probe:Drosophila_2:1628696_at:411:651; Interrogation_Position=796; Antisense; TAATATCAGGTCCAAACGCAGCCCA
>probe:Drosophila_2:1628696_at:207:147; Interrogation_Position=853; Antisense; ACTAAGCACATGTTCCATTCATTTT
>probe:Drosophila_2:1628696_at:116:691; Interrogation_Position=878; Antisense; TTTGTTGCCCATTTAAGCAGTGTTT
>probe:Drosophila_2:1628696_at:647:201; Interrogation_Position=917; Antisense; AAGCTAAGCATTTTGTACGTATTTA

Paste this into a BLAST search page for me
AGAGCAAATAAACGCACGACGCATTCACACAATCAGCCATCACCTGTAATATCACCTGTAATCAGCCACTTCAATAGCCACTTCAATAGAGGACGCACTTTAGAGGACGCACTTGGAGAGCCAATATCACCGAACACAGTTTTGAATTCAGAGACAAACACATGTTTCCTTTATCCAAACCATTTTTTCTGTGCTGCTACGTGCTGCTACTCATATTTTTCTATTGCACCATTGGTCTACTAAAAGCAGGTAATATCAGGTCCAAACGCAGCCCAACTAAGCACATGTTCCATTCATTTTTTTGTTGCCCATTTAAGCAGTGTTTAAGCTAAGCATTTTGTACGTATTTA

Full Affymetrix probeset data:

Annotations for 1628696_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720