Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628699_at:

>probe:Drosophila_2:1628699_at:576:641; Interrogation_Position=2169; Antisense; TCTTCATGGTGGTGCCGTACGTGGC
>probe:Drosophila_2:1628699_at:334:661; Interrogation_Position=2225; Antisense; TACACCTACTCCTGTGGTATCGGAT
>probe:Drosophila_2:1628699_at:515:467; Interrogation_Position=2241; Antisense; GTATCGGATCCGGAGCGCGCTACGT
>probe:Drosophila_2:1628699_at:341:413; Interrogation_Position=2294; Antisense; GACCGTGCGATCGACGAGTACGAGT
>probe:Drosophila_2:1628699_at:681:489; Interrogation_Position=2335; Antisense; GTACTTCAAGGACGTGTCCATCTAC
>probe:Drosophila_2:1628699_at:563:129; Interrogation_Position=2369; Antisense; ACCATGGAGCCCTACTACAAGTACA
>probe:Drosophila_2:1628699_at:473:489; Interrogation_Position=2389; Antisense; GTACAAGAGCTACTCCAACTACGGC
>probe:Drosophila_2:1628699_at:347:489; Interrogation_Position=2452; Antisense; GTACTTCAAGTTCTGAGCGTCGTCG
>probe:Drosophila_2:1628699_at:278:715; Interrogation_Position=2462; Antisense; TTCTGAGCGTCGTCGTTGTGTGTGC
>probe:Drosophila_2:1628699_at:113:597; Interrogation_Position=2478; Antisense; TGTGTGTGCGGCTTCGATTGCGAAA
>probe:Drosophila_2:1628699_at:85:721; Interrogation_Position=2495; Antisense; TTGCGAAATCCGGAAAACGATCACG
>probe:Drosophila_2:1628699_at:229:383; Interrogation_Position=2520; Antisense; GAACGATCTACTGAATGAGCGCGGA
>probe:Drosophila_2:1628699_at:303:417; Interrogation_Position=2536; Antisense; GAGCGCGGATGTTTTTAGAGTGTCT
>probe:Drosophila_2:1628699_at:403:99; Interrogation_Position=2552; Antisense; AGAGTGTCTGATACCTAGCTAGTAA

Paste this into a BLAST search page for me
TCTTCATGGTGGTGCCGTACGTGGCTACACCTACTCCTGTGGTATCGGATGTATCGGATCCGGAGCGCGCTACGTGACCGTGCGATCGACGAGTACGAGTGTACTTCAAGGACGTGTCCATCTACACCATGGAGCCCTACTACAAGTACAGTACAAGAGCTACTCCAACTACGGCGTACTTCAAGTTCTGAGCGTCGTCGTTCTGAGCGTCGTCGTTGTGTGTGCTGTGTGTGCGGCTTCGATTGCGAAATTGCGAAATCCGGAAAACGATCACGGAACGATCTACTGAATGAGCGCGGAGAGCGCGGATGTTTTTAGAGTGTCTAGAGTGTCTGATACCTAGCTAGTAA

Full Affymetrix probeset data:

Annotations for 1628699_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime