FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628700_at:

>probe:Drosophila_2:1628700_at:325:209; Interrogation_Position=319; Antisense; AAGCATAGCCAATTACCCGGAGAAC
>probe:Drosophila_2:1628700_at:17:575; Interrogation_Position=383; Antisense; GGCTGGAATCGCTGAAGGACTATCT
>probe:Drosophila_2:1628700_at:673:403; Interrogation_Position=400; Antisense; GACTATCTGCCCATTATGGTGCTGG
>probe:Drosophila_2:1628700_at:688:437; Interrogation_Position=429; Antisense; GAGGACAACATTCCTCTGCTGGGCA
>probe:Drosophila_2:1628700_at:424:281; Interrogation_Position=442; Antisense; CTCTGCTGGGCACTTGTGGACAGAA
>probe:Drosophila_2:1628700_at:33:461; Interrogation_Position=532; Antisense; GATTTCTCAAATGATACGCATCCCA
>probe:Drosophila_2:1628700_at:685:103; Interrogation_Position=614; Antisense; AGACGACCACTGAAGCCGAGCAGGA
>probe:Drosophila_2:1628700_at:281:681; Interrogation_Position=645; Antisense; TATGGACTCCGATATCTTGATAATT
>probe:Drosophila_2:1628700_at:496:55; Interrogation_Position=712; Antisense; ATGACCGTATTCAACAGCACCTTGT
>probe:Drosophila_2:1628700_at:419:187; Interrogation_Position=724; Antisense; AACAGCACCTTGTCGGTTGGCCGGA
>probe:Drosophila_2:1628700_at:346:417; Interrogation_Position=747; Antisense; GAGCGCCATGCGTTGTGTGGCAAAT
>probe:Drosophila_2:1628700_at:277:569; Interrogation_Position=821; Antisense; GGCATTCCCTTTTGATAACGCAGCA
>probe:Drosophila_2:1628700_at:436:107; Interrogation_Position=870; Antisense; AGAACATCATCTCCATCTCGAACTG
>probe:Drosophila_2:1628700_at:283:383; Interrogation_Position=889; Antisense; GAACTGATCCTGCATGAGCCTTTGG

Paste this into a BLAST search page for me
AAGCATAGCCAATTACCCGGAGAACGGCTGGAATCGCTGAAGGACTATCTGACTATCTGCCCATTATGGTGCTGGGAGGACAACATTCCTCTGCTGGGCACTCTGCTGGGCACTTGTGGACAGAAGATTTCTCAAATGATACGCATCCCAAGACGACCACTGAAGCCGAGCAGGATATGGACTCCGATATCTTGATAATTATGACCGTATTCAACAGCACCTTGTAACAGCACCTTGTCGGTTGGCCGGAGAGCGCCATGCGTTGTGTGGCAAATGGCATTCCCTTTTGATAACGCAGCAAGAACATCATCTCCATCTCGAACTGGAACTGATCCTGCATGAGCCTTTGG

Full Affymetrix probeset data:

Annotations for 1628700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720