Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628701_a_at:

>probe:Drosophila_2:1628701_a_at:203:139; Interrogation_Position=339; Antisense; ACGTCTCGTGAGTTTCCTTCGGTGA
>probe:Drosophila_2:1628701_a_at:82:153; Interrogation_Position=384; Antisense; ACATCCTGGACTTGGCTGACTCTGG
>probe:Drosophila_2:1628701_a_at:440:559; Interrogation_Position=427; Antisense; GGACAACACTCGATTTTGCGGCAAC
>probe:Drosophila_2:1628701_a_at:14:571; Interrogation_Position=461; Antisense; GGCATTAGCATGCTCAGCGACTGAA
>probe:Drosophila_2:1628701_a_at:659:613; Interrogation_Position=482; Antisense; TGAAGCGCGTGACCAAGGATCCCAT
>probe:Drosophila_2:1628701_a_at:99:57; Interrogation_Position=505; Antisense; ATGACTTTGTCAGCCACTCTGAGGA
>probe:Drosophila_2:1628701_a_at:606:709; Interrogation_Position=559; Antisense; TTAAGAGTGCCCTAGCGCGATACGA
>probe:Drosophila_2:1628701_a_at:131:35; Interrogation_Position=610; Antisense; ATCAGTCGTGGTTCAAGGAGCGCTT
>probe:Drosophila_2:1628701_a_at:538:553; Interrogation_Position=626; Antisense; GGAGCGCTTGGTCGAAACGAACCTT
>probe:Drosophila_2:1628701_a_at:232:29; Interrogation_Position=657; Antisense; ATACGCATAGTTTCCTTTTCTCACA
>probe:Drosophila_2:1628701_a_at:317:689; Interrogation_Position=724; Antisense; TATTCCGGTTTGGTGATCAGCTAAT
>probe:Drosophila_2:1628701_a_at:646:103; Interrogation_Position=756; Antisense; AGACGGCGGACTGCGACGGATTACA
>probe:Drosophila_2:1628701_a_at:256:155; Interrogation_Position=778; Antisense; ACACGACGTGATTCAGCCATGTAAT
>probe:Drosophila_2:1628701_a_at:330:663; Interrogation_Position=867; Antisense; TAAATATTGGGCTCACCTTTCTCAC

Paste this into a BLAST search page for me
ACGTCTCGTGAGTTTCCTTCGGTGAACATCCTGGACTTGGCTGACTCTGGGGACAACACTCGATTTTGCGGCAACGGCATTAGCATGCTCAGCGACTGAATGAAGCGCGTGACCAAGGATCCCATATGACTTTGTCAGCCACTCTGAGGATTAAGAGTGCCCTAGCGCGATACGAATCAGTCGTGGTTCAAGGAGCGCTTGGAGCGCTTGGTCGAAACGAACCTTATACGCATAGTTTCCTTTTCTCACATATTCCGGTTTGGTGATCAGCTAATAGACGGCGGACTGCGACGGATTACAACACGACGTGATTCAGCCATGTAATTAAATATTGGGCTCACCTTTCTCAC

Full Affymetrix probeset data:

Annotations for 1628701_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime