Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628702_at:

>probe:Drosophila_2:1628702_at:354:189; Interrogation_Position=48150; Antisense; AACAGTCACAAAGCCATCATTGCCA
>probe:Drosophila_2:1628702_at:390:147; Interrogation_Position=48178; Antisense; ACTACTCAAACTTCCACAGTGTCAA
>probe:Drosophila_2:1628702_at:287:175; Interrogation_Position=48201; Antisense; AAAAACTATGGGAGGATTTGCTGCA
>probe:Drosophila_2:1628702_at:219:477; Interrogation_Position=48259; Antisense; GTTATAAAGTATTCTCTGAGCCCAA
>probe:Drosophila_2:1628702_at:620:279; Interrogation_Position=48272; Antisense; CTCTGAGCCCAAACAATGAAACGAT
>probe:Drosophila_2:1628702_at:410:391; Interrogation_Position=48289; Antisense; GAAACGATTCCAATTTCACCAAAGG
>probe:Drosophila_2:1628702_at:585:243; Interrogation_Position=48300; Antisense; AATTTCACCAAAGGACCCGTGCACT
>probe:Drosophila_2:1628702_at:207:411; Interrogation_Position=48313; Antisense; GACCCGTGCACTTCAATACTACAAA
>probe:Drosophila_2:1628702_at:644:181; Interrogation_Position=48335; Antisense; AAAAAATTAGTCAAGCTCATCAGCA
>probe:Drosophila_2:1628702_at:54:657; Interrogation_Position=48360; Antisense; TAATGATTCCAGTCACAGTGCAGAA
>probe:Drosophila_2:1628702_at:661:685; Interrogation_Position=48493; Antisense; TATCTCGATCATATTTTGGCTGGAA
>probe:Drosophila_2:1628702_at:589:327; Interrogation_Position=48530; Antisense; GCGATATGCGCCTTGCAGTAGTTAA
>probe:Drosophila_2:1628702_at:609:83; Interrogation_Position=48591; Antisense; AGTGATGTTCCATAAGGCAATGCAA
>probe:Drosophila_2:1628702_at:454:409; Interrogation_Position=48618; Antisense; GACGAGTGCCAGAAAACAGTATTTA

Paste this into a BLAST search page for me
AACAGTCACAAAGCCATCATTGCCAACTACTCAAACTTCCACAGTGTCAAAAAAACTATGGGAGGATTTGCTGCAGTTATAAAGTATTCTCTGAGCCCAACTCTGAGCCCAAACAATGAAACGATGAAACGATTCCAATTTCACCAAAGGAATTTCACCAAAGGACCCGTGCACTGACCCGTGCACTTCAATACTACAAAAAAAAATTAGTCAAGCTCATCAGCATAATGATTCCAGTCACAGTGCAGAATATCTCGATCATATTTTGGCTGGAAGCGATATGCGCCTTGCAGTAGTTAAAGTGATGTTCCATAAGGCAATGCAAGACGAGTGCCAGAAAACAGTATTTA

Full Affymetrix probeset data:

Annotations for 1628702_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime