FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628704_at:

>probe:Drosophila_2:1628704_at:644:279; Interrogation_Position=1130; Antisense; CTACATATATGGCAGTGAGTTTTTC
>probe:Drosophila_2:1628704_at:231:685; Interrogation_Position=1135; Antisense; TATATGGCAGTGAGTTTTTCCTTAC
>probe:Drosophila_2:1628704_at:120:67; Interrogation_Position=1138; Antisense; ATGGCAGTGAGTTTTTCCTTACTTA
>probe:Drosophila_2:1628704_at:246:559; Interrogation_Position=1140; Antisense; GGCAGTGAGTTTTTCCTTACTTACA
>probe:Drosophila_2:1628704_at:70:513; Interrogation_Position=1144; Antisense; GTGAGTTTTTCCTTACTTACATGGC
>probe:Drosophila_2:1628704_at:324:429; Interrogation_Position=1146; Antisense; GAGTTTTTCCTTACTTACATGGCAT
>probe:Drosophila_2:1628704_at:631:477; Interrogation_Position=1148; Antisense; GTTTTTCCTTACTTACATGGCATTT
>probe:Drosophila_2:1628704_at:441:693; Interrogation_Position=1151; Antisense; TTTCCTTACTTACATGGCATTTATT
>probe:Drosophila_2:1628704_at:64:153; Interrogation_Position=1162; Antisense; ACATGGCATTTATTATTCAATTTTA
>probe:Drosophila_2:1628704_at:427:15; Interrogation_Position=1181; Antisense; ATTTTAATTCATGTGTTGGCTTTCA
>probe:Drosophila_2:1628704_at:57:655; Interrogation_Position=1185; Antisense; TAATTCATGTGTTGGCTTTCAGACA
>probe:Drosophila_2:1628704_at:193:647; Interrogation_Position=1189; Antisense; TCATGTGTTGGCTTTCAGACATTGA
>probe:Drosophila_2:1628704_at:595:513; Interrogation_Position=1193; Antisense; GTGTTGGCTTTCAGACATTGAAGTT
>probe:Drosophila_2:1628704_at:254:581; Interrogation_Position=1197; Antisense; TGGCTTTCAGACATTGAAGTTTTCA

Paste this into a BLAST search page for me
CTACATATATGGCAGTGAGTTTTTCTATATGGCAGTGAGTTTTTCCTTACATGGCAGTGAGTTTTTCCTTACTTAGGCAGTGAGTTTTTCCTTACTTACAGTGAGTTTTTCCTTACTTACATGGCGAGTTTTTCCTTACTTACATGGCATGTTTTTCCTTACTTACATGGCATTTTTTCCTTACTTACATGGCATTTATTACATGGCATTTATTATTCAATTTTAATTTTAATTCATGTGTTGGCTTTCATAATTCATGTGTTGGCTTTCAGACATCATGTGTTGGCTTTCAGACATTGAGTGTTGGCTTTCAGACATTGAAGTTTGGCTTTCAGACATTGAAGTTTTCA

Full Affymetrix probeset data:

Annotations for 1628704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720