FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628705_at:

>probe:Drosophila_2:1628705_at:76:125; Interrogation_Position=1691; Antisense; AGCGCGCCTTTGAGGGTCTCAATCT
>probe:Drosophila_2:1628705_at:589:7; Interrogation_Position=1726; Antisense; ATTGCCACCGTTCTATTCTATATGA
>probe:Drosophila_2:1628705_at:722:81; Interrogation_Position=1763; Antisense; AGGGAGGAGCCACTGTCTTCACATC
>probe:Drosophila_2:1628705_at:666:155; Interrogation_Position=1793; Antisense; ACACCGCTCTGTTTCCCAAGAAGGG
>probe:Drosophila_2:1628705_at:105:293; Interrogation_Position=1890; Antisense; CGTACTCACAGGCACCAAGTGGGTG
>probe:Drosophila_2:1628705_at:68:93; Interrogation_Position=1985; Antisense; AGTTCGCCATCTAATCCGGAGTCTA
>probe:Drosophila_2:1628705_at:104:305; Interrogation_Position=2000; Antisense; CCGGAGTCTAGTATGCGTATGCAAC
>probe:Drosophila_2:1628705_at:76:87; Interrogation_Position=2033; Antisense; AGTGCGAAATCTCATCCTTCGTCAT
>probe:Drosophila_2:1628705_at:364:579; Interrogation_Position=2059; Antisense; GGCCATCGACTTCCTATTGTAAATA
>probe:Drosophila_2:1628705_at:54:71; Interrogation_Position=2092; Antisense; AGGCCGAAGAAGGTCGCATCTGTTC
>probe:Drosophila_2:1628705_at:641:345; Interrogation_Position=2107; Antisense; GCATCTGTTCTACTTATCGGTTCAT
>probe:Drosophila_2:1628705_at:51:277; Interrogation_Position=2119; Antisense; CTTATCGGTTCATCGTACATGGGAA
>probe:Drosophila_2:1628705_at:403:561; Interrogation_Position=2140; Antisense; GGAACCAACTTCAACCTAGCTGTAT
>probe:Drosophila_2:1628705_at:550:675; Interrogation_Position=2156; Antisense; TAGCTGTATCCTAGACTCGTATGGA

Paste this into a BLAST search page for me
AGCGCGCCTTTGAGGGTCTCAATCTATTGCCACCGTTCTATTCTATATGAAGGGAGGAGCCACTGTCTTCACATCACACCGCTCTGTTTCCCAAGAAGGGCGTACTCACAGGCACCAAGTGGGTGAGTTCGCCATCTAATCCGGAGTCTACCGGAGTCTAGTATGCGTATGCAACAGTGCGAAATCTCATCCTTCGTCATGGCCATCGACTTCCTATTGTAAATAAGGCCGAAGAAGGTCGCATCTGTTCGCATCTGTTCTACTTATCGGTTCATCTTATCGGTTCATCGTACATGGGAAGGAACCAACTTCAACCTAGCTGTATTAGCTGTATCCTAGACTCGTATGGA

Full Affymetrix probeset data:

Annotations for 1628705_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720