FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628706_at:

>probe:Drosophila_2:1628706_at:205:541; Interrogation_Position=322; Antisense; GGATTTGTGTTACCCCAACTGGTCG
>probe:Drosophila_2:1628706_at:682:27; Interrogation_Position=370; Antisense; ATACCCCTGCTGACAAGGTTGGAGA
>probe:Drosophila_2:1628706_at:526:223; Interrogation_Position=430; Antisense; AAGGTGAATACAGCCACGTCAGCAC
>probe:Drosophila_2:1628706_at:367:415; Interrogation_Position=540; Antisense; GACCAATTGTGAGCCTTTTGCCATA
>probe:Drosophila_2:1628706_at:437:371; Interrogation_Position=590; Antisense; GAAGGAGCACGACCGGTGTAACTCT
>probe:Drosophila_2:1628706_at:649:515; Interrogation_Position=605; Antisense; GTGTAACTCTCTTGGCCAGCAAAAG
>probe:Drosophila_2:1628706_at:321:193; Interrogation_Position=637; Antisense; AACTACGACGAGGACGTGCTGGCCG
>probe:Drosophila_2:1628706_at:399:581; Interrogation_Position=656; Antisense; TGGCCGATCGGTCACCAGCGAATAG
>probe:Drosophila_2:1628706_at:476:323; Interrogation_Position=673; Antisense; GCGAATAGCGACTACCGGGAGCAAC
>probe:Drosophila_2:1628706_at:20:309; Interrogation_Position=704; Antisense; CCATTGGGCTCATGCTGGACGAAAT
>probe:Drosophila_2:1628706_at:31:423; Interrogation_Position=747; Antisense; GAGAAAGCCCCGTCTAGTGTACGCC
>probe:Drosophila_2:1628706_at:635:351; Interrogation_Position=789; Antisense; GCAGCACCTGCGAATGTGCCAGTAT
>probe:Drosophila_2:1628706_at:667:213; Interrogation_Position=835; Antisense; AAGAGATTCCGCTTTGATACTCCCT
>probe:Drosophila_2:1628706_at:363:57; Interrogation_Position=866; Antisense; ATGAGCTCGTCAAGCAGGCGCTGCA

Paste this into a BLAST search page for me
GGATTTGTGTTACCCCAACTGGTCGATACCCCTGCTGACAAGGTTGGAGAAAGGTGAATACAGCCACGTCAGCACGACCAATTGTGAGCCTTTTGCCATAGAAGGAGCACGACCGGTGTAACTCTGTGTAACTCTCTTGGCCAGCAAAAGAACTACGACGAGGACGTGCTGGCCGTGGCCGATCGGTCACCAGCGAATAGGCGAATAGCGACTACCGGGAGCAACCCATTGGGCTCATGCTGGACGAAATGAGAAAGCCCCGTCTAGTGTACGCCGCAGCACCTGCGAATGTGCCAGTATAAGAGATTCCGCTTTGATACTCCCTATGAGCTCGTCAAGCAGGCGCTGCA

Full Affymetrix probeset data:

Annotations for 1628706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720