FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628707_at:

>probe:Drosophila_2:1628707_at:205:115; Interrogation_Position=176; Antisense; AGCAGAGTCCCCATTGCAGTGGACG
>probe:Drosophila_2:1628707_at:415:331; Interrogation_Position=203; Antisense; GCGGACGCATCCTGCGCGAAAGTAG
>probe:Drosophila_2:1628707_at:262:467; Interrogation_Position=24; Antisense; GTTGAGTGTGAACAGCATCCAGGAT
>probe:Drosophila_2:1628707_at:580:59; Interrogation_Position=247; Antisense; ATGTTCGATGCTCTGCTCCGCGATG
>probe:Drosophila_2:1628707_at:396:59; Interrogation_Position=269; Antisense; ATGATCACGAACATCGGCTGAGCTT
>probe:Drosophila_2:1628707_at:60:641; Interrogation_Position=282; Antisense; TCGGCTGAGCTTGGATGCAGTGCAT
>probe:Drosophila_2:1628707_at:634:617; Interrogation_Position=297; Antisense; TGCAGTGCATCGCATGCGGCATGTT
>probe:Drosophila_2:1628707_at:716:615; Interrogation_Position=331; Antisense; TGCACCACAATTCCCGAGGAGGATG
>probe:Drosophila_2:1628707_at:246:437; Interrogation_Position=349; Antisense; GAGGATGCCGTCAGCGATCGCAGCC
>probe:Drosophila_2:1628707_at:172:45; Interrogation_Position=365; Antisense; ATCGCAGCCTGCAGATTCATCTCTC
>probe:Drosophila_2:1628707_at:351:581; Interrogation_Position=395; Antisense; TGGCCCGCGAACGTGAACAGGAACT
>probe:Drosophila_2:1628707_at:12:49; Interrogation_Position=40; Antisense; ATCCAGGATGCGGTCATCGATCGCT
>probe:Drosophila_2:1628707_at:376:189; Interrogation_Position=416; Antisense; AACTTGAGCTTGAGCGCCAGCGGGA
>probe:Drosophila_2:1628707_at:3:519; Interrogation_Position=73; Antisense; GTGGCTTTGACCACCGATGCCAACG

Paste this into a BLAST search page for me
AGCAGAGTCCCCATTGCAGTGGACGGCGGACGCATCCTGCGCGAAAGTAGGTTGAGTGTGAACAGCATCCAGGATATGTTCGATGCTCTGCTCCGCGATGATGATCACGAACATCGGCTGAGCTTTCGGCTGAGCTTGGATGCAGTGCATTGCAGTGCATCGCATGCGGCATGTTTGCACCACAATTCCCGAGGAGGATGGAGGATGCCGTCAGCGATCGCAGCCATCGCAGCCTGCAGATTCATCTCTCTGGCCCGCGAACGTGAACAGGAACTATCCAGGATGCGGTCATCGATCGCTAACTTGAGCTTGAGCGCCAGCGGGAGTGGCTTTGACCACCGATGCCAACG

Full Affymetrix probeset data:

Annotations for 1628707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720