FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628708_at:

>probe:Drosophila_2:1628708_at:508:579; Interrogation_Position=2165; Antisense; GGCCACAGGCCAGCAGAAGGAGCAA
>probe:Drosophila_2:1628708_at:406:99; Interrogation_Position=2189; Antisense; AGAGGAGCAGAACTTGGACAACATC
>probe:Drosophila_2:1628708_at:85:111; Interrogation_Position=2218; Antisense; AGAATGGAATCATCAGCCTGGACAT
>probe:Drosophila_2:1628708_at:15:573; Interrogation_Position=2266; Antisense; GGCTGCCCACATACGAGGGTGCCAT
>probe:Drosophila_2:1628708_at:587:531; Interrogation_Position=2282; Antisense; GGGTGCCATCAAACTGGAGTCCAGT
>probe:Drosophila_2:1628708_at:18:505; Interrogation_Position=2300; Antisense; GTCCAGTGGTTATGTGTGAGCCTAA
>probe:Drosophila_2:1628708_at:58:607; Interrogation_Position=2316; Antisense; TGAGCCTAACAAGCAGTTCACATTA
>probe:Drosophila_2:1628708_at:360:473; Interrogation_Position=2331; Antisense; GTTCACATTAGTTGTATGGCTGCAA
>probe:Drosophila_2:1628708_at:295:485; Interrogation_Position=2344; Antisense; GTATGGCTGCAAACCGAAACCTAAA
>probe:Drosophila_2:1628708_at:84:129; Interrogation_Position=2368; Antisense; ACCACAATCGTGCTTTAACTATGAT
>probe:Drosophila_2:1628708_at:165:181; Interrogation_Position=2566; Antisense; AAAAATATCACGCTCTCAGTACAGA
>probe:Drosophila_2:1628708_at:112:419; Interrogation_Position=2647; Antisense; GAGCTAAGCCAGTGCATATCCCTGT
>probe:Drosophila_2:1628708_at:512:23; Interrogation_Position=2662; Antisense; ATATCCCTGTAAATGTTCGTGTCAA
>probe:Drosophila_2:1628708_at:635:471; Interrogation_Position=2676; Antisense; GTTCGTGTCAAGTACTCGTATCAAT

Paste this into a BLAST search page for me
GGCCACAGGCCAGCAGAAGGAGCAAAGAGGAGCAGAACTTGGACAACATCAGAATGGAATCATCAGCCTGGACATGGCTGCCCACATACGAGGGTGCCATGGGTGCCATCAAACTGGAGTCCAGTGTCCAGTGGTTATGTGTGAGCCTAATGAGCCTAACAAGCAGTTCACATTAGTTCACATTAGTTGTATGGCTGCAAGTATGGCTGCAAACCGAAACCTAAAACCACAATCGTGCTTTAACTATGATAAAAATATCACGCTCTCAGTACAGAGAGCTAAGCCAGTGCATATCCCTGTATATCCCTGTAAATGTTCGTGTCAAGTTCGTGTCAAGTACTCGTATCAAT

Full Affymetrix probeset data:

Annotations for 1628708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720