FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628710_at:

>probe:Drosophila_2:1628710_at:204:125; Interrogation_Position=1020; Antisense; AGCCAACATCTTTATACCCGGCGTT
>probe:Drosophila_2:1628710_at:344:477; Interrogation_Position=1042; Antisense; GTTTTCGATCCCAGTACGCAGCAAA
>probe:Drosophila_2:1628710_at:566:199; Interrogation_Position=1066; Antisense; AACGCTAACGCTCTAGGTGGCATAC
>probe:Drosophila_2:1628710_at:311:683; Interrogation_Position=1195; Antisense; TATCCAGCCGGTGCACAGACAGTGC
>probe:Drosophila_2:1628710_at:284:87; Interrogation_Position=1215; Antisense; AGTGCCGTCGTATCCGCAGGTGCAA
>probe:Drosophila_2:1628710_at:613:79; Interrogation_Position=1232; Antisense; AGGTGCAACCCTCCATGGGCGGACT
>probe:Drosophila_2:1628710_at:315:351; Interrogation_Position=1287; Antisense; GCAGATGGCCCATGTGTTTGCACCA
>probe:Drosophila_2:1628710_at:617:71; Interrogation_Position=1347; Antisense; AGGCAACGACGAACTATCCGGACCG
>probe:Drosophila_2:1628710_at:416:39; Interrogation_Position=1362; Antisense; ATCCGGACCGGCAGTGAATCAGGCT
>probe:Drosophila_2:1628710_at:610:435; Interrogation_Position=805; Antisense; GAGGTCAGACCACCGACTATTGAGC
>probe:Drosophila_2:1628710_at:186:261; Interrogation_Position=830; Antisense; CACCGGCACAGAGCTTGTTCAAGAC
>probe:Drosophila_2:1628710_at:608:289; Interrogation_Position=866; Antisense; CGGATGAGGCTACCGATGCCCTAAC
>probe:Drosophila_2:1628710_at:317:517; Interrogation_Position=952; Antisense; GTGGCTGACGTGTCCGTAGCGCAAC
>probe:Drosophila_2:1628710_at:313:487; Interrogation_Position=967; Antisense; GTAGCGCAACCTCAGGTTCAGGTGC

Paste this into a BLAST search page for me
AGCCAACATCTTTATACCCGGCGTTGTTTTCGATCCCAGTACGCAGCAAAAACGCTAACGCTCTAGGTGGCATACTATCCAGCCGGTGCACAGACAGTGCAGTGCCGTCGTATCCGCAGGTGCAAAGGTGCAACCCTCCATGGGCGGACTGCAGATGGCCCATGTGTTTGCACCAAGGCAACGACGAACTATCCGGACCGATCCGGACCGGCAGTGAATCAGGCTGAGGTCAGACCACCGACTATTGAGCCACCGGCACAGAGCTTGTTCAAGACCGGATGAGGCTACCGATGCCCTAACGTGGCTGACGTGTCCGTAGCGCAACGTAGCGCAACCTCAGGTTCAGGTGC

Full Affymetrix probeset data:

Annotations for 1628710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720