FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628711_at:

>probe:Drosophila_2:1628711_at:58:229; Interrogation_Position=120; Antisense; AATGGCATGGTCACCTATGGCAGCG
>probe:Drosophila_2:1628711_at:89:447; Interrogation_Position=245; Antisense; GATGCAGCAGGTACAGCCACAGGCG
>probe:Drosophila_2:1628711_at:480:199; Interrogation_Position=316; Antisense; AACGAATGGAGACCCGGTATCCTGC
>probe:Drosophila_2:1628711_at:92:31; Interrogation_Position=347; Antisense; ATACATGTCCAAGCCAAGCCAACAG
>probe:Drosophila_2:1628711_at:465:155; Interrogation_Position=368; Antisense; ACAGAGCTCTGTGAGTTGTCCTGGC
>probe:Drosophila_2:1628711_at:9:319; Interrogation_Position=416; Antisense; GCCGTCTAACAATCTCGCGATGATG
>probe:Drosophila_2:1628711_at:511:445; Interrogation_Position=437; Antisense; GATGCAACCGTTGCAGGCGCAGATT
>probe:Drosophila_2:1628711_at:528:297; Interrogation_Position=454; Antisense; CGCAGATTTTACAGCGCCAGCAAAT
>probe:Drosophila_2:1628711_at:661:167; Interrogation_Position=475; Antisense; AAATGCAAACCTCCATGGGCAGTCC
>probe:Drosophila_2:1628711_at:148:595; Interrogation_Position=490; Antisense; TGGGCAGTCCTTGCGGCTACTACAA
>probe:Drosophila_2:1628711_at:35:145; Interrogation_Position=508; Antisense; ACTACAACCTGCCAACGAATGCGGG
>probe:Drosophila_2:1628711_at:538:543; Interrogation_Position=578; Antisense; GGATGCCAACAAGCCGTATACCTTT
>probe:Drosophila_2:1628711_at:593:27; Interrogation_Position=595; Antisense; ATACCTTTGGCTGGAGTCTTACCGA
>probe:Drosophila_2:1628711_at:358:93; Interrogation_Position=99; Antisense; AGTTCACCGCAAGTGCCACAGAATG

Paste this into a BLAST search page for me
AATGGCATGGTCACCTATGGCAGCGGATGCAGCAGGTACAGCCACAGGCGAACGAATGGAGACCCGGTATCCTGCATACATGTCCAAGCCAAGCCAACAGACAGAGCTCTGTGAGTTGTCCTGGCGCCGTCTAACAATCTCGCGATGATGGATGCAACCGTTGCAGGCGCAGATTCGCAGATTTTACAGCGCCAGCAAATAAATGCAAACCTCCATGGGCAGTCCTGGGCAGTCCTTGCGGCTACTACAAACTACAACCTGCCAACGAATGCGGGGGATGCCAACAAGCCGTATACCTTTATACCTTTGGCTGGAGTCTTACCGAAGTTCACCGCAAGTGCCACAGAATG

Full Affymetrix probeset data:

Annotations for 1628711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720