Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628712_at:

>probe:Drosophila_2:1628712_at:30:303; Interrogation_Position=2149; Antisense; CCGCCCAGTGCTACAAAAAAGAAGA
>probe:Drosophila_2:1628712_at:691:379; Interrogation_Position=2178; Antisense; GAAGCCAGTGAGATTGGATCCAATC
>probe:Drosophila_2:1628712_at:500:545; Interrogation_Position=2193; Antisense; GGATCCAATCTGCTATAATAGGCGT
>probe:Drosophila_2:1628712_at:353:249; Interrogation_Position=2198; Antisense; CAATCTGCTATAATAGGCGTCCCAG
>probe:Drosophila_2:1628712_at:31:341; Interrogation_Position=2204; Antisense; GCTATAATAGGCGTCCCAGATGTGT
>probe:Drosophila_2:1628712_at:128:239; Interrogation_Position=2209; Antisense; AATAGGCGTCCCAGATGTGTCGAGT
>probe:Drosophila_2:1628712_at:324:681; Interrogation_Position=2211; Antisense; TAGGCGTCCCAGATGTGTCGAGTTT
>probe:Drosophila_2:1628712_at:207:329; Interrogation_Position=2214; Antisense; GCGTCCCAGATGTGTCGAGTTTGTC
>probe:Drosophila_2:1628712_at:576:503; Interrogation_Position=2216; Antisense; GTCCCAGATGTGTCGAGTTTGTCGA
>probe:Drosophila_2:1628712_at:681:441; Interrogation_Position=2222; Antisense; GATGTGTCGAGTTTGTCGACTACTA
>probe:Drosophila_2:1628712_at:531:429; Interrogation_Position=2230; Antisense; GAGTTTGTCGACTACTATAACATGT
>probe:Drosophila_2:1628712_at:480:501; Interrogation_Position=2236; Antisense; GTCGACTACTATAACATGTAAATGC
>probe:Drosophila_2:1628712_at:58:491; Interrogation_Position=2253; Antisense; GTAAATGCTAGACAGACAAGACAAC
>probe:Drosophila_2:1628712_at:484:147; Interrogation_Position=2289; Antisense; ACTATAAACATTTAAGCCAAGCTAA

Paste this into a BLAST search page for me
CCGCCCAGTGCTACAAAAAAGAAGAGAAGCCAGTGAGATTGGATCCAATCGGATCCAATCTGCTATAATAGGCGTCAATCTGCTATAATAGGCGTCCCAGGCTATAATAGGCGTCCCAGATGTGTAATAGGCGTCCCAGATGTGTCGAGTTAGGCGTCCCAGATGTGTCGAGTTTGCGTCCCAGATGTGTCGAGTTTGTCGTCCCAGATGTGTCGAGTTTGTCGAGATGTGTCGAGTTTGTCGACTACTAGAGTTTGTCGACTACTATAACATGTGTCGACTACTATAACATGTAAATGCGTAAATGCTAGACAGACAAGACAACACTATAAACATTTAAGCCAAGCTAA

Full Affymetrix probeset data:

Annotations for 1628712_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime