Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628713_at:

>probe:Drosophila_2:1628713_at:261:441; Interrogation_Position=127; Antisense; GATGGCTATGCCTTCTCATTCGAGA
>probe:Drosophila_2:1628713_at:410:683; Interrogation_Position=162; Antisense; TATCTCGCGTGAGGAGAGGGCCACT
>probe:Drosophila_2:1628713_at:18:99; Interrogation_Position=176; Antisense; AGAGGGCCACTCTGAAAAATCCTGG
>probe:Drosophila_2:1628713_at:328:531; Interrogation_Position=19; Antisense; GGCTTAACACTGCTTTTCGGCCTAA
>probe:Drosophila_2:1628713_at:201:181; Interrogation_Position=190; Antisense; AAAAATCCTGGCACTCCCGAGGAGG
>probe:Drosophila_2:1628713_at:230:439; Interrogation_Position=211; Antisense; GAGGCAATCGCCATCCAGGGCAGCG
>probe:Drosophila_2:1628713_at:558:533; Interrogation_Position=243; Antisense; GGTGGGACCTGATGGTATTCACTAT
>probe:Drosophila_2:1628713_at:532:685; Interrogation_Position=265; Antisense; TATAAGCTGAACTATCTGGCCGATG
>probe:Drosophila_2:1628713_at:498:381; Interrogation_Position=291; Antisense; GAACGGTTTTCAGGCTCAGGGCGAA
>probe:Drosophila_2:1628713_at:263:83; Interrogation_Position=308; Antisense; AGGGCGAACATCTTCCCCAGGTAGA
>probe:Drosophila_2:1628713_at:349:537; Interrogation_Position=327; Antisense; GGTAGAGCACTCATCACGTGATAGG
>probe:Drosophila_2:1628713_at:681:655; Interrogation_Position=41; Antisense; TAATCCTGGTCAGCTTCTGCGCGTG
>probe:Drosophila_2:1628713_at:30:717; Interrogation_Position=55; Antisense; TTCTGCGCGTGTTCCTCAAATGCCA
>probe:Drosophila_2:1628713_at:358:167; Interrogation_Position=72; Antisense; AAATGCCACCGATACTGCCCAGATA

Paste this into a BLAST search page for me
GATGGCTATGCCTTCTCATTCGAGATATCTCGCGTGAGGAGAGGGCCACTAGAGGGCCACTCTGAAAAATCCTGGGGCTTAACACTGCTTTTCGGCCTAAAAAAATCCTGGCACTCCCGAGGAGGGAGGCAATCGCCATCCAGGGCAGCGGGTGGGACCTGATGGTATTCACTATTATAAGCTGAACTATCTGGCCGATGGAACGGTTTTCAGGCTCAGGGCGAAAGGGCGAACATCTTCCCCAGGTAGAGGTAGAGCACTCATCACGTGATAGGTAATCCTGGTCAGCTTCTGCGCGTGTTCTGCGCGTGTTCCTCAAATGCCAAAATGCCACCGATACTGCCCAGATA

Full Affymetrix probeset data:

Annotations for 1628713_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime