FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628714_at:

>probe:Drosophila_2:1628714_at:82:493; Interrogation_Position=1033; Antisense; GTAACAGCTTTGACGCTCGCGAGAT
>probe:Drosophila_2:1628714_at:651:447; Interrogation_Position=1055; Antisense; GATCCTCAAGCGCTTTGGAGACTTC
>probe:Drosophila_2:1628714_at:236:149; Interrogation_Position=1075; Antisense; ACTTCGATTTCGGAGTAGCCCAGTG
>probe:Drosophila_2:1628714_at:719:505; Interrogation_Position=1097; Antisense; GTGCCAGGCTGTACATCTGTGCGTA
>probe:Drosophila_2:1628714_at:270:725; Interrogation_Position=1122; Antisense; TTGAATTCGCGCTCCGAGGATGAGT
>probe:Drosophila_2:1628714_at:659:655; Interrogation_Position=671; Antisense; TAAGGAGCTTTTCACTCCGGAGTGC
>probe:Drosophila_2:1628714_at:721:85; Interrogation_Position=691; Antisense; AGTGCTGCATTCATCTTACCTTAGG
>probe:Drosophila_2:1628714_at:605:671; Interrogation_Position=707; Antisense; TACCTTAGGCGTCTATGTGCTGCTA
>probe:Drosophila_2:1628714_at:224:365; Interrogation_Position=761; Antisense; GAATCTGGAATCATGTCGTCGTTTA
>probe:Drosophila_2:1628714_at:486:499; Interrogation_Position=775; Antisense; GTCGTCGTTTACTGGATGGCCTTAA
>probe:Drosophila_2:1628714_at:418:681; Interrogation_Position=836; Antisense; TATGAACGACGATCCAAGCTCCACT
>probe:Drosophila_2:1628714_at:391:637; Interrogation_Position=880; Antisense; TCGAGTCTCCGGATCTGCAAAAGTT
>probe:Drosophila_2:1628714_at:249:217; Interrogation_Position=900; Antisense; AAGTTTGCGGATCAGTGTCTGGCCC
>probe:Drosophila_2:1628714_at:358:533; Interrogation_Position=992; Antisense; GGTGATGAACAACCGCTACCGCAAT

Paste this into a BLAST search page for me
GTAACAGCTTTGACGCTCGCGAGATGATCCTCAAGCGCTTTGGAGACTTCACTTCGATTTCGGAGTAGCCCAGTGGTGCCAGGCTGTACATCTGTGCGTATTGAATTCGCGCTCCGAGGATGAGTTAAGGAGCTTTTCACTCCGGAGTGCAGTGCTGCATTCATCTTACCTTAGGTACCTTAGGCGTCTATGTGCTGCTAGAATCTGGAATCATGTCGTCGTTTAGTCGTCGTTTACTGGATGGCCTTAATATGAACGACGATCCAAGCTCCACTTCGAGTCTCCGGATCTGCAAAAGTTAAGTTTGCGGATCAGTGTCTGGCCCGGTGATGAACAACCGCTACCGCAAT

Full Affymetrix probeset data:

Annotations for 1628714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720