Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628715_a_at:

>probe:Drosophila_2:1628715_a_at:379:713; Interrogation_Position=1033; Antisense; TTCTGTTAAAACTGTCGTCCACCCT
>probe:Drosophila_2:1628715_a_at:577:637; Interrogation_Position=1047; Antisense; TCGTCCACCCTCTTAACTGAAATAG
>probe:Drosophila_2:1628715_a_at:301:151; Interrogation_Position=507; Antisense; ACATTGGCAGCACACGGAGGACATA
>probe:Drosophila_2:1628715_a_at:79:607; Interrogation_Position=534; Antisense; TGAGGGCATCTACAACACATACGTT
>probe:Drosophila_2:1628715_a_at:455:271; Interrogation_Position=551; Antisense; CATACGTTCTGGACACGGACTACGA
>probe:Drosophila_2:1628715_a_at:291:287; Interrogation_Position=586; Antisense; CTGGTGATGCACTGCGCCGAGAAGA
>probe:Drosophila_2:1628715_a_at:27:375; Interrogation_Position=609; Antisense; GAAGAAGCAACCACGTTACCTGTCC
>probe:Drosophila_2:1628715_a_at:559:321; Interrogation_Position=634; Antisense; GCCCTGCTTTTGTCGCGGAAAACAT
>probe:Drosophila_2:1628715_a_at:312:727; Interrogation_Position=661; Antisense; TTGGCCGACAACGAGATCAGCTTTC
>probe:Drosophila_2:1628715_a_at:55:95; Interrogation_Position=695; Antisense; AGTTGCCGCAGGATATCGACACATC
>probe:Drosophila_2:1628715_a_at:117:153; Interrogation_Position=731; Antisense; ACATCGGGCAGGAATCGTGCGACAA
>probe:Drosophila_2:1628715_a_at:615:365; Interrogation_Position=763; Antisense; GAATCTAGTCGCGACGATCCACTGG
>probe:Drosophila_2:1628715_a_at:283:205; Interrogation_Position=841; Antisense; AAGCCTGACGGCAGAGTGCGCGCTA
>probe:Drosophila_2:1628715_a_at:593:117; Interrogation_Position=949; Antisense; AGCTACATTGCTCTCTTTTAGTTAT

Paste this into a BLAST search page for me
TTCTGTTAAAACTGTCGTCCACCCTTCGTCCACCCTCTTAACTGAAATAGACATTGGCAGCACACGGAGGACATATGAGGGCATCTACAACACATACGTTCATACGTTCTGGACACGGACTACGACTGGTGATGCACTGCGCCGAGAAGAGAAGAAGCAACCACGTTACCTGTCCGCCCTGCTTTTGTCGCGGAAAACATTTGGCCGACAACGAGATCAGCTTTCAGTTGCCGCAGGATATCGACACATCACATCGGGCAGGAATCGTGCGACAAGAATCTAGTCGCGACGATCCACTGGAAGCCTGACGGCAGAGTGCGCGCTAAGCTACATTGCTCTCTTTTAGTTAT

Full Affymetrix probeset data:

Annotations for 1628715_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime