Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628716_at:

>probe:Drosophila_2:1628716_at:574:25; Interrogation_Position=1391; Antisense; ATAGTTTCGTATCGCCTTATGTGGA
>probe:Drosophila_2:1628716_at:647:115; Interrogation_Position=1437; Antisense; AGCATATTTCTTGAGGCACTTCCTT
>probe:Drosophila_2:1628716_at:20:705; Interrogation_Position=1503; Antisense; TTATGCCACACACGGCTTGGAACTT
>probe:Drosophila_2:1628716_at:411:645; Interrogation_Position=1547; Antisense; TCTTGGATACCGATGGCCACTATAC
>probe:Drosophila_2:1628716_at:324:277; Interrogation_Position=1566; Antisense; CTATACCGCCATGGATTGCCTAGAA
>probe:Drosophila_2:1628716_at:498:139; Interrogation_Position=1590; Antisense; ACGGCAATCATTCCAACACTACGAT
>probe:Drosophila_2:1628716_at:448:103; Interrogation_Position=1636; Antisense; AGACCACTTGGTTCGCACGAGATCG
>probe:Drosophila_2:1628716_at:713:443; Interrogation_Position=1656; Antisense; GATCGCCGAGATCTTCCAGTTTTAT
>probe:Drosophila_2:1628716_at:592:699; Interrogation_Position=1676; Antisense; TTTATCGCTCTTTTCAGTATTCCCT
>probe:Drosophila_2:1628716_at:462:141; Interrogation_Position=1702; Antisense; ACGGACTATCACTTTTGGCTTCAGG
>probe:Drosophila_2:1628716_at:706:719; Interrogation_Position=1742; Antisense; TTGCCGAGACCTTTGTGCTGGACTA
>probe:Drosophila_2:1628716_at:368:153; Interrogation_Position=1784; Antisense; ACAGGGTACTCTTCTATGCGGTGGC
>probe:Drosophila_2:1628716_at:428:621; Interrogation_Position=1800; Antisense; TGCGGTGGCCCAGCAGTTATGTAAC
>probe:Drosophila_2:1628716_at:716:339; Interrogation_Position=1862; Antisense; GCTATATGAATCTTCCCGAGTTCCA

Paste this into a BLAST search page for me
ATAGTTTCGTATCGCCTTATGTGGAAGCATATTTCTTGAGGCACTTCCTTTTATGCCACACACGGCTTGGAACTTTCTTGGATACCGATGGCCACTATACCTATACCGCCATGGATTGCCTAGAAACGGCAATCATTCCAACACTACGATAGACCACTTGGTTCGCACGAGATCGGATCGCCGAGATCTTCCAGTTTTATTTTATCGCTCTTTTCAGTATTCCCTACGGACTATCACTTTTGGCTTCAGGTTGCCGAGACCTTTGTGCTGGACTAACAGGGTACTCTTCTATGCGGTGGCTGCGGTGGCCCAGCAGTTATGTAACGCTATATGAATCTTCCCGAGTTCCA

Full Affymetrix probeset data:

Annotations for 1628716_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime