FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628718_at:

>probe:Drosophila_2:1628718_at:648:221; Interrogation_Position=1000; Antisense; AAGTGGTGGCCCCAAACGCAGATGT
>probe:Drosophila_2:1628718_at:483:541; Interrogation_Position=1038; Antisense; GGTTCGATTGTTCATCACTCATGGA
>probe:Drosophila_2:1628718_at:260:71; Interrogation_Position=1068; Antisense; AGGCAGTGTCTCAGAAGCTCTTTTT
>probe:Drosophila_2:1628718_at:611:117; Interrogation_Position=1083; Antisense; AGCTCTTTTTTACGGAGTGCCCATG
>probe:Drosophila_2:1628718_at:92:529; Interrogation_Position=1110; Antisense; GGGACTACCCTTAATTGGCGATCAA
>probe:Drosophila_2:1628718_at:625:527; Interrogation_Position=1170; Antisense; GGGTTTGACCTTATCCACCAACAAT
>probe:Drosophila_2:1628718_at:714:247; Interrogation_Position=1277; Antisense; AATTGTATCGCGATCGTCCAGTGAG
>probe:Drosophila_2:1628718_at:132:433; Interrogation_Position=1299; Antisense; GAGTCCCAGCGATTTGGTGACCTAT
>probe:Drosophila_2:1628718_at:186:663; Interrogation_Position=1356; Antisense; TAAAAATTTGCACAATCCCGCCAGG
>probe:Drosophila_2:1628718_at:189:477; Interrogation_Position=1426; Antisense; GTTTATGGGCTCTTAATCCTAACGA
>probe:Drosophila_2:1628718_at:525:173; Interrogation_Position=901; Antisense; AAAGCTTTTGCTCAGTTTCCGGACT
>probe:Drosophila_2:1628718_at:291:557; Interrogation_Position=921; Antisense; GGACTATGACATTTACTGGACCTAC
>probe:Drosophila_2:1628718_at:458:679; Interrogation_Position=960; Antisense; TAGTGCCATCAGCTTGGATTACCCT
>probe:Drosophila_2:1628718_at:172:639; Interrogation_Position=973; Antisense; TTGGATTACCCTCACCTTAAAGTCG

Paste this into a BLAST search page for me
AAGTGGTGGCCCCAAACGCAGATGTGGTTCGATTGTTCATCACTCATGGAAGGCAGTGTCTCAGAAGCTCTTTTTAGCTCTTTTTTACGGAGTGCCCATGGGGACTACCCTTAATTGGCGATCAAGGGTTTGACCTTATCCACCAACAATAATTGTATCGCGATCGTCCAGTGAGGAGTCCCAGCGATTTGGTGACCTATTAAAAATTTGCACAATCCCGCCAGGGTTTATGGGCTCTTAATCCTAACGAAAAGCTTTTGCTCAGTTTCCGGACTGGACTATGACATTTACTGGACCTACTAGTGCCATCAGCTTGGATTACCCTTTGGATTACCCTCACCTTAAAGTCG

Full Affymetrix probeset data:

Annotations for 1628718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720