FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628719_at:

>probe:Drosophila_2:1628719_at:201:419; Interrogation_Position=1352; Antisense; GAGCATGGACTGCAGCACTTTCTGA
>probe:Drosophila_2:1628719_at:575:465; Interrogation_Position=1394; Antisense; GATTGGTCGGTCTGCGCTGGCAACT
>probe:Drosophila_2:1628719_at:425:593; Interrogation_Position=1424; Antisense; TGGGTATCCAGCTCGGCGTTTGAAA
>probe:Drosophila_2:1628719_at:537:327; Interrogation_Position=1439; Antisense; GCGTTTGAAAGGCTGCTGGACTCCT
>probe:Drosophila_2:1628719_at:359:253; Interrogation_Position=1492; Antisense; CAAGCGACTTGATCCGGATGGCACC
>probe:Drosophila_2:1628719_at:308:67; Interrogation_Position=1509; Antisense; ATGGCACCTACATCAAGCAGTACGT
>probe:Drosophila_2:1628719_at:22:671; Interrogation_Position=1529; Antisense; TACGTCCCGGAGTTGATGAATGTGC
>probe:Drosophila_2:1628719_at:656:363; Interrogation_Position=1559; Antisense; GAATTTGTTCACGAGCCCTGGCGAA
>probe:Drosophila_2:1628719_at:664:667; Interrogation_Position=1607; Antisense; TACGAGTGCCTGATCGGAGTCCATT
>probe:Drosophila_2:1628719_at:520:453; Interrogation_Position=1642; Antisense; GATCATTGATTTGTCCATGGCCGTA
>probe:Drosophila_2:1628719_at:154:53; Interrogation_Position=1676; Antisense; ATGCTGGCCATGAAGTCTCTCCGAA
>probe:Drosophila_2:1628719_at:108:89; Interrogation_Position=1689; Antisense; AGTCTCTCCGAAATTCGCTGATCAC
>probe:Drosophila_2:1628719_at:619:5; Interrogation_Position=1725; Antisense; ATTGCCGACCATCCAACGAGGAGGA
>probe:Drosophila_2:1628719_at:145:221; Interrogation_Position=1749; Antisense; AAGTGCGTCAGTTCTTCTGGCTGGC

Paste this into a BLAST search page for me
GAGCATGGACTGCAGCACTTTCTGAGATTGGTCGGTCTGCGCTGGCAACTTGGGTATCCAGCTCGGCGTTTGAAAGCGTTTGAAAGGCTGCTGGACTCCTCAAGCGACTTGATCCGGATGGCACCATGGCACCTACATCAAGCAGTACGTTACGTCCCGGAGTTGATGAATGTGCGAATTTGTTCACGAGCCCTGGCGAATACGAGTGCCTGATCGGAGTCCATTGATCATTGATTTGTCCATGGCCGTAATGCTGGCCATGAAGTCTCTCCGAAAGTCTCTCCGAAATTCGCTGATCACATTGCCGACCATCCAACGAGGAGGAAAGTGCGTCAGTTCTTCTGGCTGGC

Full Affymetrix probeset data:

Annotations for 1628719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720