Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628720_at:

>probe:Drosophila_2:1628720_at:403:461; Interrogation_Position=105; Antisense; GATTTTCTGTCTGATTGCTCTGTTT
>probe:Drosophila_2:1628720_at:489:7; Interrogation_Position=118; Antisense; ATTGCTCTGTTTGCCATAGCCTCGG
>probe:Drosophila_2:1628720_at:665:265; Interrogation_Position=13; Antisense; CAGTTGCAGTTTTATCCTCAAAGAC
>probe:Drosophila_2:1628720_at:308:493; Interrogation_Position=146; Antisense; GTCCCCAGTTCGGATTCGGCGGATT
>probe:Drosophila_2:1628720_at:567:109; Interrogation_Position=191; Antisense; AGCAACAGCAGGGCGGTTTTGGACA
>probe:Drosophila_2:1628720_at:623:517; Interrogation_Position=224; Antisense; GTGGTTTCGGTTCCTTTGGACAGCA
>probe:Drosophila_2:1628720_at:449:699; Interrogation_Position=23; Antisense; TTTATCCTCAAAGACGATTCATCAT
>probe:Drosophila_2:1628720_at:725:639; Interrogation_Position=230; Antisense; TCGGTTCCTTTGGACAGCAGCAACA
>probe:Drosophila_2:1628720_at:506:357; Interrogation_Position=249; Antisense; GCAACAGCAGGAAAGTTTTGGCGGA
>probe:Drosophila_2:1628720_at:259:229; Interrogation_Position=274; Antisense; AATGGAAACTTTGGTCAGCAGCAAC
>probe:Drosophila_2:1628720_at:471:255; Interrogation_Position=295; Antisense; CAACAAGAGTTTGGTGGTTTCGGCG
>probe:Drosophila_2:1628720_at:349:463; Interrogation_Position=38; Antisense; GATTCATCATATACTCTTACTCCAG
>probe:Drosophila_2:1628720_at:562:703; Interrogation_Position=54; Antisense; TTACTCCAGTATCGCTAAAGAAGCT
>probe:Drosophila_2:1628720_at:256:245; Interrogation_Position=98; Antisense; AATTCTTGATTTTCTGTCTGATTGC

Paste this into a BLAST search page for me
GATTTTCTGTCTGATTGCTCTGTTTATTGCTCTGTTTGCCATAGCCTCGGCAGTTGCAGTTTTATCCTCAAAGACGTCCCCAGTTCGGATTCGGCGGATTAGCAACAGCAGGGCGGTTTTGGACAGTGGTTTCGGTTCCTTTGGACAGCATTTATCCTCAAAGACGATTCATCATTCGGTTCCTTTGGACAGCAGCAACAGCAACAGCAGGAAAGTTTTGGCGGAAATGGAAACTTTGGTCAGCAGCAACCAACAAGAGTTTGGTGGTTTCGGCGGATTCATCATATACTCTTACTCCAGTTACTCCAGTATCGCTAAAGAAGCTAATTCTTGATTTTCTGTCTGATTGC

Full Affymetrix probeset data:

Annotations for 1628720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime