FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628722_at:

>probe:Drosophila_2:1628722_at:29:85; Interrogation_Position=454; Antisense; AGTGGAGCTCGCTGTACGGATGCCA
>probe:Drosophila_2:1628722_at:508:231; Interrogation_Position=483; Antisense; AATGAATCTCATGTTGGCCACCGGA
>probe:Drosophila_2:1628722_at:91:565; Interrogation_Position=505; Antisense; GGAATGCTCTCCTCCATAATAATCA
>probe:Drosophila_2:1628722_at:97:351; Interrogation_Position=538; Antisense; GCAGCAGTCTTTTCCCGATACGAGG
>probe:Drosophila_2:1628722_at:83:341; Interrogation_Position=581; Antisense; GCTTCTACTATTGTTTTGTCACCTT
>probe:Drosophila_2:1628722_at:128:411; Interrogation_Position=606; Antisense; GACGACAATTGGTTTCGGCGATTAT
>probe:Drosophila_2:1628722_at:526:569; Interrogation_Position=633; Antisense; GGCATTGCAGAACGACCAAGCTCTA
>probe:Drosophila_2:1628722_at:678:659; Interrogation_Position=663; Antisense; TAAGCCTGGCTATGTGGCGCTGAGC
>probe:Drosophila_2:1628722_at:469:607; Interrogation_Position=683; Antisense; TGAGCTTGGTCTTCATCCTATTCGG
>probe:Drosophila_2:1628722_at:567:521; Interrogation_Position=718; Antisense; GTGGCCGCCAGTATCAATCTATTGG
>probe:Drosophila_2:1628722_at:44:37; Interrogation_Position=734; Antisense; ATCTATTGGTGCTCCGATTCATGAC
>probe:Drosophila_2:1628722_at:450:127; Interrogation_Position=829; Antisense; ACCTTCGATGATGAGTCCACGTACA
>probe:Drosophila_2:1628722_at:243:239; Interrogation_Position=952; Antisense; AATCATGAGCAGTTCGTGGACCCGG
>probe:Drosophila_2:1628722_at:121:401; Interrogation_Position=991; Antisense; GACATTATCGAGAGCACCTTGTGCC

Paste this into a BLAST search page for me
AGTGGAGCTCGCTGTACGGATGCCAAATGAATCTCATGTTGGCCACCGGAGGAATGCTCTCCTCCATAATAATCAGCAGCAGTCTTTTCCCGATACGAGGGCTTCTACTATTGTTTTGTCACCTTGACGACAATTGGTTTCGGCGATTATGGCATTGCAGAACGACCAAGCTCTATAAGCCTGGCTATGTGGCGCTGAGCTGAGCTTGGTCTTCATCCTATTCGGGTGGCCGCCAGTATCAATCTATTGGATCTATTGGTGCTCCGATTCATGACACCTTCGATGATGAGTCCACGTACAAATCATGAGCAGTTCGTGGACCCGGGACATTATCGAGAGCACCTTGTGCC

Full Affymetrix probeset data:

Annotations for 1628722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720